Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZYX cdna clone

ZYX cDNA Clone

Gene Names
ZYX; ESP-2; HED-2
Synonyms
ZYX; ZYX cDNA Clone; ZYX cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccccccgcccgtctcccgcgatctccgtttcggtctcggctccggctttttacgccccgcagaagaagttcggccctgtggtggccccaaagcccaaagtgaatcccttccggcccggggacagcgagcctcccccggcacccggggcccagcgcgcacagatgggccgggtgggcgagattcccccgccgcccccggaagactttcccctgcctccacctccccttgctggggatggcgacgatgcagagggtgctctgggaggtgccttcccgccgccccctcccccgatcgaggaatcatttccccctgcgcctctggaggaggagatcttcccttccccgccgcctcctccggaggaggagggagggcctgaggcccccataccgcccccaccacagcccagggagaaggtgagcagtattgatttggagatcgactctctgtcctcactgctggatgacatgaccaagaatgatcctttcaaagcccgggtgtcatctggatatgtgcccccaccagtggccactccattcagttccaagtccagtaccaagcctgcagccgggggcacagcacccctgcctccttggaagtccccttccagctcccagcctctgccccaggttccggctccggctcagagccagacacagttccatgttcagccccagccccagcccaagcctcaggtccaactccatgtccagtcccagacccagcctgtgtctttggctaacacccagccccgagggcccccagcctcatctccggctccagcccctaagttttctccagtgactcctaagtttactcctgtggcttccaagttcagtcctggagccccaggtggatctgggtcacaaccaaatcaaaaattggggcaccccgaagctctttctgctggcacaggctcccctcaacctcccagcttcacctatgcccagcagagggagaagccccgagtgcaggagaagcagcaccccgtgcccccaccggctcagaaccaaaaccaggtgcgctcccctggggccccagggcccctgactctgaaggaggtggaggagctggagcagctgacccagcagctaatgcaggacatggagcatcctcagaggcagaatgtggctgtcaacgaactctgcggccgatgccatcaacccctggcccgggcgcagccagccgtccgcgctctagggcagctgttccacatcgcctgcttcacctgccaccagtgtgcgcagcagctccagggccagcagttctacagtctggagggggcgccgtactgcgagggctgttacactgacaccctggagaagtgtaacacctgcggggagcccatcactgaccgcatgctgagggccacgggcaaggcctatcacccgcactgcttcacctgtgtggtctgcgcccgccccctggagggcacctccttcatcgtggaccaggccaaccggccccactgtgtccccgactaccacaagcagtacgccccgaggtgctccgtctgctctgagcccatcatgcctgagcctggccgagatgagactgtgcgagtggtcgccctggacaagaacttccacatgaagtgttacaagtgtgaggactgcgggaagcccctgtcgattgaggcagatgacaatggctgcttccccctggacggtcacgtgctctgtcggaagtgccacactgctagagcccagacctga
Sequence Length
1719
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,075 Da
NCBI Official Full Name
Homo sapiens zyxin, mRNA
NCBI Official Synonym Full Names
zyxin
NCBI Official Symbol
ZYX
NCBI Official Synonym Symbols
ESP-2; HED-2
NCBI Protein Information
zyxin
UniProt Protein Name
Zyxin
Protein Family
UniProt Gene Name
ZYX
UniProt Entry Name
ZYX_HUMAN

NCBI Description

Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Jul 2008]

Uniprot Description

Zyxin: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression. Interacts with HPV type 6 protein E6. Does not interact significantly with E6 proteins from HPV types 11, 16, or 18. Interacts, via the Pro-rich regions, with the EVH1 domains of ENAH, EVL and VASP. Interacts with the first LIM domain of TES. Interacts with NEBL (isoform 2). Belongs to the zyxin/ajuba family.

Protein type: Motility/polarity/chemotaxis; Cell adhesion

Chromosomal Location of Human Ortholog: 7q32

Cellular Component: cell-cell adherens junction; cytoplasm; focal adhesion; integral to plasma membrane; nucleus; plasma membrane; stress fiber

Molecular Function: protein binding

Biological Process: cell adhesion; cell-cell signaling; cell-matrix adhesion; integrin-mediated signaling pathway; signal transduction; stress fiber formation; transforming growth factor beta receptor signaling pathway

Research Articles on ZYX

Similar Products

Product Notes

The ZYX zyx (Catalog #AAA1265870) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccc cccgcccgtc tcccgcgatc tccgtttcgg tctcggctcc ggctttttac gccccgcaga agaagttcgg ccctgtggtg gccccaaagc ccaaagtgaa tcccttccgg cccggggaca gcgagcctcc cccggcaccc ggggcccagc gcgcacagat gggccgggtg ggcgagattc ccccgccgcc cccggaagac tttcccctgc ctccacctcc ccttgctggg gatggcgacg atgcagaggg tgctctggga ggtgccttcc cgccgccccc tcccccgatc gaggaatcat ttccccctgc gcctctggag gaggagatct tcccttcccc gccgcctcct ccggaggagg agggagggcc tgaggccccc ataccgcccc caccacagcc cagggagaag gtgagcagta ttgatttgga gatcgactct ctgtcctcac tgctggatga catgaccaag aatgatcctt tcaaagcccg ggtgtcatct ggatatgtgc ccccaccagt ggccactcca ttcagttcca agtccagtac caagcctgca gccgggggca cagcacccct gcctccttgg aagtcccctt ccagctccca gcctctgccc caggttccgg ctccggctca gagccagaca cagttccatg ttcagcccca gccccagccc aagcctcagg tccaactcca tgtccagtcc cagacccagc ctgtgtcttt ggctaacacc cagccccgag ggcccccagc ctcatctccg gctccagccc ctaagttttc tccagtgact cctaagttta ctcctgtggc ttccaagttc agtcctggag ccccaggtgg atctgggtca caaccaaatc aaaaattggg gcaccccgaa gctctttctg ctggcacagg ctcccctcaa cctcccagct tcacctatgc ccagcagagg gagaagcccc gagtgcagga gaagcagcac cccgtgcccc caccggctca gaaccaaaac caggtgcgct cccctggggc cccagggccc ctgactctga aggaggtgga ggagctggag cagctgaccc agcagctaat gcaggacatg gagcatcctc agaggcagaa tgtggctgtc aacgaactct gcggccgatg ccatcaaccc ctggcccggg cgcagccagc cgtccgcgct ctagggcagc tgttccacat cgcctgcttc acctgccacc agtgtgcgca gcagctccag ggccagcagt tctacagtct ggagggggcg ccgtactgcg agggctgtta cactgacacc ctggagaagt gtaacacctg cggggagccc atcactgacc gcatgctgag ggccacgggc aaggcctatc acccgcactg cttcacctgt gtggtctgcg cccgccccct ggagggcacc tccttcatcg tggaccaggc caaccggccc cactgtgtcc ccgactacca caagcagtac gccccgaggt gctccgtctg ctctgagccc atcatgcctg agcctggccg agatgagact gtgcgagtgg tcgccctgga caagaacttc cacatgaagt gttacaagtg tgaggactgc gggaagcccc tgtcgattga ggcagatgac aatggctgct tccccctgga cggtcacgtg ctctgtcgga agtgccacac tgctagagcc cagacctga. It is sometimes possible for the material contained within the vial of "ZYX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.