Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF649 cdna clone

ZNF649 cDNA Clone

Synonyms
ZNF649; ZNF649 cDNA Clone; ZNF649 cdna clone
Ordering
For Research Use Only!
Sequence
atgacaaaggcccaggaatcactgaccctggaggatgtggctgtggacttcacctgggaggagtggcagttcctgagccctgctcagaaggacctgtaccgggatgtgatgttggagaactacagcaaccttgtgtcagtggggtatcaagccggcaaacctgatgccctcaccaagttggaacaaggagaaccactatggacactagaagatgaaatccacagtccagcccacccagaaattgagaaagctgatgatcatctgcagcagcccttgcaaaaccaaaaaatactgaagaggacgggacaacgctatgaacacggaagaactttgaaatcatatttaggtttaaccaaccagagcagaagatacaacagaaaggagcctgctgagtttaatggagatggagcttttctccatgataatcatgaacaaatgcctacggaaattgaattccctgaaagtagaaaacccatcagcaccaagtcacaattccttaaacatcagcaaacacacaacatagagaaagcccatgaatgcactgactgtgggaaagctttcctcaagaagtctcagctcactgagcataagagaattcatacaggaaagaaaccccacgtgtgtagcttgtgtgggaaagccttctacaagaagtacaggctcactgaacacgagagagctcacagaggagagaaaccccacgggtgtagcttgtgtgggaaagccttctacaagaggtacaggctcactgaacacgagagagctcacaaaggagagaaaccatacgggtgcagtgaatgtgggaaagccttccccaggaaatctgagcttactgaacatcaaaggattcacacgggaattaagccccatcaatgcagcgaatgtgggagagctttctccagaaaatcactactcgttgtacatcagcgaactcatacaggagagaagcctcatacatgcagtgaatgtggaaaaggcttcattcagaagggcaatctcaacatacatcaacgaactcacactggagagaaaccttatggatgcattgactgtggcaaggccttcagccagaagtcttgccttgtagcacatcagagatatcatacaggaaagactccctttgtatgtcctgaatgtgggcaaccctgttcacagaagtcaggactcattagacatcagaaaattcactcaggagagaaaccctataaatgcagtgactgtgggaaagccttccttacaaagacaatgctcattgtacatcacagaactcacacgggagagagaccctatggctgtgatgagtgtgagaaagcttacttctatatgtcttgccttgttaaacataagagaatacactcaagggagaaacggggggattcagtgaaggtggaaaatccttccacagcaagtcacagcttaagtcctagtgaacatgtgcaggggaaaagccctgttaatatggtaactgtggcaatggtggcagggcagtgtgagtttgcccacatcctgcattcatga
Sequence Length
1518
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,683 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 649, mRNA
NCBI Official Synonym Full Names
zinc finger protein 649
NCBI Official Symbol
ZNF649
NCBI Protein Information
zinc finger protein 649
UniProt Protein Name
Zinc finger protein 649
Protein Family
UniProt Gene Name
ZNF649
UniProt Entry Name
ZN649_HUMAN

Uniprot Description

ZNF649: Transcriptional repressor. Regulator of transcriptional factor complexes and may suppress SRE and AP-1 transcription activities mediated by growth factor signaling pathways. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 19q13.41

Cellular Component: extracellular space; nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter

Research Articles on ZNF649

Similar Products

Product Notes

The ZNF649 znf649 (Catalog #AAA1273988) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacaaagg cccaggaatc actgaccctg gaggatgtgg ctgtggactt cacctgggag gagtggcagt tcctgagccc tgctcagaag gacctgtacc gggatgtgat gttggagaac tacagcaacc ttgtgtcagt ggggtatcaa gccggcaaac ctgatgccct caccaagttg gaacaaggag aaccactatg gacactagaa gatgaaatcc acagtccagc ccacccagaa attgagaaag ctgatgatca tctgcagcag cccttgcaaa accaaaaaat actgaagagg acgggacaac gctatgaaca cggaagaact ttgaaatcat atttaggttt aaccaaccag agcagaagat acaacagaaa ggagcctgct gagtttaatg gagatggagc ttttctccat gataatcatg aacaaatgcc tacggaaatt gaattccctg aaagtagaaa acccatcagc accaagtcac aattccttaa acatcagcaa acacacaaca tagagaaagc ccatgaatgc actgactgtg ggaaagcttt cctcaagaag tctcagctca ctgagcataa gagaattcat acaggaaaga aaccccacgt gtgtagcttg tgtgggaaag ccttctacaa gaagtacagg ctcactgaac acgagagagc tcacagagga gagaaacccc acgggtgtag cttgtgtggg aaagccttct acaagaggta caggctcact gaacacgaga gagctcacaa aggagagaaa ccatacgggt gcagtgaatg tgggaaagcc ttccccagga aatctgagct tactgaacat caaaggattc acacgggaat taagccccat caatgcagcg aatgtgggag agctttctcc agaaaatcac tactcgttgt acatcagcga actcatacag gagagaagcc tcatacatgc agtgaatgtg gaaaaggctt cattcagaag ggcaatctca acatacatca acgaactcac actggagaga aaccttatgg atgcattgac tgtggcaagg ccttcagcca gaagtcttgc cttgtagcac atcagagata tcatacagga aagactccct ttgtatgtcc tgaatgtggg caaccctgtt cacagaagtc aggactcatt agacatcaga aaattcactc aggagagaaa ccctataaat gcagtgactg tgggaaagcc ttccttacaa agacaatgct cattgtacat cacagaactc acacgggaga gagaccctat ggctgtgatg agtgtgagaa agcttacttc tatatgtctt gccttgttaa acataagaga atacactcaa gggagaaacg gggggattca gtgaaggtgg aaaatccttc cacagcaagt cacagcttaa gtcctagtga acatgtgcag gggaaaagcc ctgttaatat ggtaactgtg gcaatggtgg cagggcagtg tgagtttgcc cacatcctgc attcatga. It is sometimes possible for the material contained within the vial of "ZNF649, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.