Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF408 cdna clone

ZNF408 cDNA Clone

Gene Names
ZNF408; EVR6; RP72
Synonyms
ZNF408; ZNF408 cDNA Clone; ZNF408 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggaggcggaggagctgctcttggaggggaagaaggcgctgcaactcgcccgcgagccgcgcctgggcctggacttaggatggaacccttccggagaaggctgtacgcagggcctcaaagacgtcccacccgagccgacccgagacatcctcgctttaaagagccttccccggggcttggcccttggcccctcactcgccaaggaacagcgcttgggggtctggtgtgtcggggaccccctgcagcccggcctgctgtgggggccgctggaagaggagtctgcctccaaggagaagggcgagggagtaaagccacggcaggaggagaacctgtcattaggcccatggggagacgtgtgtgcctgtgagcagagttctggctggactagcttggtacaacggggcaggctggagagtgagggaaatgtggccccagtgcggatcagcgagaggcttcatctgcaagtgtaccagctggtgctgccaggctctgaactgctgctgtggccccagccttcctctgagggcccaagtctcacccagcctgggctggacaaagaggcagctgtagcagtggtgacagaagtggagtctgctgtacagcaggaagtggcctcccctggggaggatgcagcagaaccttgcatagatcctggttcccagtcaccctctggcatccaggcagagaatatggtgagccctggacttaagttcccaacccaggaccgaatttccaaggatagccagccacttggcccattgcttcaggatggcgacgtggatgaggaatgcccggcccaggcacagatgccacctgaacttcagagcaattcggctacccagcaggacccagatggcagtggagccagtttctcatcttctgccaggggcacccagccgcatggctacctggccaagaagttacacagccccagtgatcagtgcccacccagagcaaagaccccagagcctggagcccagcagtctggcttccctacactctcgcggagccctcctggcccagcaggaagctccccaaagcaggggcgacggtaccggtgtggagagtgtggcaaggcattcctacagctgtgccacctaaagaagcacgcatttgtgcacacgggccacaagccctttctttgcactgagtgtggcaagagctatagctcagaggagagcttcaaagcccatatgctgggccaccgtggggtgcggcccttcccctgtccacaatgcgacaaggcctatggcacccagcgagacctcaaagagcaccaggtggtacattcaggtgcccggccctttgcttgtgaccagtgtggcaaggcctttgcccgccggccctccctgcggctgcatcgcaagacccaccaggtgccagctgcccctgccccttgcccatgccctgtgtgtgggcggcccctggccaaccagggctccctgcggaaccatatgaggctccatacaggagaaaagcctttcctgtgcccgcactgtggccgggcgtttcgtcagcggggcaacctgcgtgggcatttgcggctccacaccggggagcgtccttaccgctgcccacactgtgccgatgccttcccccagctgcctgaactgcggcgccatctcatctcacacaccggggaggcccacttgtgcccggtgtgtggcaaggccctccgagacccacacacgctccgagctcacgagcgcctgcactccggagagaggccctttccctgtccccagtgtggccgtgcttacacgctggccaccaagctgcggcgccacctcaaatctcacttggaggacaagccctaccgctgccccacctgtggcatgggctacaccctcccgcagagcctcaggcggcatcagctcagtcaccggcctgaggcaccctgcagcccaccctctgtgccttctgctgcttctgagcccactgtggtgctcctgcaggctgagccacaactgctggacacacacagagaggaggaagtctcccccgccagggatgttgttgaggtcaccatttcagaaagccaggagaagtgctttgtggtgccagaggagccagatgccgcccccagcctggtgctaatccataaggacatgggcctcggcgcctgggcagaggtggtggaggtggagatgggcacctga
Sequence Length
2163
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,439 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 408, mRNA
NCBI Official Synonym Full Names
zinc finger protein 408
NCBI Official Symbol
ZNF408
NCBI Official Synonym Symbols
EVR6; RP72
NCBI Protein Information
zinc finger protein 408
UniProt Protein Name
Zinc finger protein 408
Protein Family
UniProt Gene Name
ZNF408
UniProt Synonym Gene Names
PFM14; PRDM17
UniProt Entry Name
ZN408_HUMAN

Uniprot Description

ZNF408: May be involved in transcriptional regulation.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: nucleus

Molecular Function: identical protein binding; protein binding

Disease: Exudative Vitreoretinopathy 6; Retinitis Pigmentosa 72

Research Articles on ZNF408

Similar Products

Product Notes

The ZNF408 znf408 (Catalog #AAA1269153) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagg cggaggagct gctcttggag gggaagaagg cgctgcaact cgcccgcgag ccgcgcctgg gcctggactt aggatggaac ccttccggag aaggctgtac gcagggcctc aaagacgtcc cacccgagcc gacccgagac atcctcgctt taaagagcct tccccggggc ttggcccttg gcccctcact cgccaaggaa cagcgcttgg gggtctggtg tgtcggggac cccctgcagc ccggcctgct gtgggggccg ctggaagagg agtctgcctc caaggagaag ggcgagggag taaagccacg gcaggaggag aacctgtcat taggcccatg gggagacgtg tgtgcctgtg agcagagttc tggctggact agcttggtac aacggggcag gctggagagt gagggaaatg tggccccagt gcggatcagc gagaggcttc atctgcaagt gtaccagctg gtgctgccag gctctgaact gctgctgtgg ccccagcctt cctctgaggg cccaagtctc acccagcctg ggctggacaa agaggcagct gtagcagtgg tgacagaagt ggagtctgct gtacagcagg aagtggcctc ccctggggag gatgcagcag aaccttgcat agatcctggt tcccagtcac cctctggcat ccaggcagag aatatggtga gccctggact taagttccca acccaggacc gaatttccaa ggatagccag ccacttggcc cattgcttca ggatggcgac gtggatgagg aatgcccggc ccaggcacag atgccacctg aacttcagag caattcggct acccagcagg acccagatgg cagtggagcc agtttctcat cttctgccag gggcacccag ccgcatggct acctggccaa gaagttacac agccccagtg atcagtgccc acccagagca aagaccccag agcctggagc ccagcagtct ggcttcccta cactctcgcg gagccctcct ggcccagcag gaagctcccc aaagcagggg cgacggtacc ggtgtggaga gtgtggcaag gcattcctac agctgtgcca cctaaagaag cacgcatttg tgcacacggg ccacaagccc tttctttgca ctgagtgtgg caagagctat agctcagagg agagcttcaa agcccatatg ctgggccacc gtggggtgcg gcccttcccc tgtccacaat gcgacaaggc ctatggcacc cagcgagacc tcaaagagca ccaggtggta cattcaggtg cccggccctt tgcttgtgac cagtgtggca aggcctttgc ccgccggccc tccctgcggc tgcatcgcaa gacccaccag gtgccagctg cccctgcccc ttgcccatgc cctgtgtgtg ggcggcccct ggccaaccag ggctccctgc ggaaccatat gaggctccat acaggagaaa agcctttcct gtgcccgcac tgtggccggg cgtttcgtca gcggggcaac ctgcgtgggc atttgcggct ccacaccggg gagcgtcctt accgctgccc acactgtgcc gatgccttcc cccagctgcc tgaactgcgg cgccatctca tctcacacac cggggaggcc cacttgtgcc cggtgtgtgg caaggccctc cgagacccac acacgctccg agctcacgag cgcctgcact ccggagagag gccctttccc tgtccccagt gtggccgtgc ttacacgctg gccaccaagc tgcggcgcca cctcaaatct cacttggagg acaagcccta ccgctgcccc acctgtggca tgggctacac cctcccgcag agcctcaggc ggcatcagct cagtcaccgg cctgaggcac cctgcagccc accctctgtg ccttctgctg cttctgagcc cactgtggtg ctcctgcagg ctgagccaca actgctggac acacacagag aggaggaagt ctcccccgcc agggatgttg ttgaggtcac catttcagaa agccaggaga agtgctttgt ggtgccagag gagccagatg ccgcccccag cctggtgcta atccataagg acatgggcct cggcgcctgg gcagaggtgg tggaggtgga gatgggcacc tga. It is sometimes possible for the material contained within the vial of "ZNF408, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.