Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZFYVE26 cdna clone

ZFYVE26 cDNA Clone

Gene Names
ZFYVE26; SPG15; FYVE-CENT
Synonyms
ZFYVE26; ZFYVE26 cDNA Clone; ZFYVE26 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacaacacctactaccaggaatgcctcttctacctgcacaactatagcaccaacctggccatcatcagcttctacgtgaggcacagctgcctgcgggaagctcttctgcaccttctcaacaaggagagtcctccagaagtttttatagaaggcattttccaaccaagctataaaagtgggaagctacacactttggagaacttgctagaatccattgatccaaccttggagagctggggaaagtacttgattgctgcctgccaacatttacagaagaagaactactaccacattctgtatgagctgcagcagtttatgaaggaccaagttcgggccgccatgacctgtattcggttcttcagtcacaaagcaaagtcatatacagaactgggagagaagctctcatggctacttaaggccaaggaccacctgaagatctacctccaagaaacatcccgcagctctggaaggaagaaaaccacattcttcagaaagaagatgactgcagctgatgtgtcaaggcacatgaacacacttcagctgcagatggaagtgaccaggttcttgcatcggtgcgaaagtgctgggacctctcaaatcaccactttgcctctgccaaccctgtttggaaataaccacatgaaaatggatgttgcctgcaaggtcatgctgggagggaaaaatgtagaagatggttttggaattgctttccgtgttctgcaggacttccagctggatgctgccatgacctactgcagagctgcccgccagttggtggagaaagagaagtacagtgagatccagcaactgctcaaatgtgtcagtgagtcaggcatggcagccaaaagtgacggggacaccatcctcctcaactgcctggaagcgttcaagagaattccgccccaggagctggagggcctgatccaggcaatacacaatgatgacaacaaggtgagcggaattgtctccaaacgctggtga
Sequence Length
984
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,970 Da
NCBI Official Full Name
Homo sapiens zinc finger, FYVE domain containing 26, mRNA
NCBI Official Synonym Full Names
zinc finger FYVE-type containing 26
NCBI Official Symbol
ZFYVE26
NCBI Official Synonym Symbols
SPG15; FYVE-CENT
NCBI Protein Information
zinc finger FYVE domain-containing protein 26
UniProt Protein Name
Zinc finger FYVE domain-containing protein 26
UniProt Gene Name
ZFYVE26
UniProt Synonym Gene Names
KIAA0321; FYVE-CENT
UniProt Entry Name
ZFY26_HUMAN

NCBI Description

This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]

Uniprot Description

ZFYVE26: Phosphatidylinositol 3-phosphate-binding protein required for the abcission step in cytokinesis: recruited to the midbody during cytokinesis and acts as a regulator of abcission. May also be required for efficient homologous recombination DNA double-strand break repair. Interacts with AP5Z1, AP5B1, AP5S1 and SPG11. Interacts with TTC19 and KIF13A. Strongest expression in the adrenal gland, bone marrow, adult brain, fetal brain, lung, placenta, prostate, skeletal muscle, testis, thymus, and retina. Intermediate levels are detected in other structures, including the spinal cord. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 14q24.1

Cellular Component: centrosome; lysosomal membrane; midbody

Molecular Function: phosphatidylinositol 3-phosphate binding; protein binding

Biological Process: cytokinesis; double-strand break repair via homologous recombination

Disease: Spastic Paraplegia 15, Autosomal Recessive

Research Articles on ZFYVE26

Similar Products

Product Notes

The ZFYVE26 zfyve26 (Catalog #AAA1273860) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaaca cctactacca ggaatgcctc ttctacctgc acaactatag caccaacctg gccatcatca gcttctacgt gaggcacagc tgcctgcggg aagctcttct gcaccttctc aacaaggaga gtcctccaga agtttttata gaaggcattt tccaaccaag ctataaaagt gggaagctac acactttgga gaacttgcta gaatccattg atccaacctt ggagagctgg ggaaagtact tgattgctgc ctgccaacat ttacagaaga agaactacta ccacattctg tatgagctgc agcagtttat gaaggaccaa gttcgggccg ccatgacctg tattcggttc ttcagtcaca aagcaaagtc atatacagaa ctgggagaga agctctcatg gctacttaag gccaaggacc acctgaagat ctacctccaa gaaacatccc gcagctctgg aaggaagaaa accacattct tcagaaagaa gatgactgca gctgatgtgt caaggcacat gaacacactt cagctgcaga tggaagtgac caggttcttg catcggtgcg aaagtgctgg gacctctcaa atcaccactt tgcctctgcc aaccctgttt ggaaataacc acatgaaaat ggatgttgcc tgcaaggtca tgctgggagg gaaaaatgta gaagatggtt ttggaattgc tttccgtgtt ctgcaggact tccagctgga tgctgccatg acctactgca gagctgcccg ccagttggtg gagaaagaga agtacagtga gatccagcaa ctgctcaaat gtgtcagtga gtcaggcatg gcagccaaaa gtgacgggga caccatcctc ctcaactgcc tggaagcgtt caagagaatt ccgccccagg agctggaggg cctgatccag gcaatacaca atgatgacaa caaggtgagc ggaattgtct ccaaacgctg gtga. It is sometimes possible for the material contained within the vial of "ZFYVE26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.