Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZDHHC23 cdna clone

ZDHHC23 cDNA Clone

Gene Names
ZDHHC23; NIDD; DHHC-23
Synonyms
ZDHHC23; ZDHHC23 cDNA Clone; ZDHHC23 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcctgtgaagaaaaagaaaaccgaagaacctgaattggagcccctgtgctgctgcgagtacatagatcggaatggggaaaagaaccacgtggctacttgtttgtgtgattgtcaagatctggatgaagggtgtgatcgatggattacatgtaaatctttacagccagagacttgtgaaagaatcatggatacaatttctgatcgcctccgaattccttggcttaggggagccaaaaaagtgaacatcagcatcatccctccgcttgtcctgctgcctgtcttccttcatgtggcttcctggcatttcctcctgggggtggtggttttgacctcccttcctgtgctggcactgtggtactactacctcactaacagaaggaaagaacagaccctgtttttcctgagccttggactgttctctctgggctacatgtactatgtgttcctgcaggaagtggtccccaaagggcgtgtgggtcccgttcagctggcggttcttacctgcgggttatttctgatactcttagccttgcacagagccaagaagaatccaggctacctcagcaatccagcaagcggtgacagatctctaagcagcagccagctggagtgcctgagcagaaaagggcaggagaaggccaaagggttccctggggcagacatgtcgggcagtctcaacaatcgcacaacaaaggatgaccccaagggctcttccaagatgccagctggaagccccaccaaagcgaaggaggactggtgtgccaagtgccagctggtgcgaccagcccgggcatggcgctgccggatatgtggcatctgtgtgaggagaatggatcatcattgtgtctggataaatagctgcgttggagaatcaaatcatcaagcatttatacttgcccttttgatcttcttgctcacctcggtgtatgggatcacactgaccttggacaccatttgtagagacagaagtgtcttcacagctcttttctattgtcctggagtttatgcaaattacagctcggctctgtccttcacctgcgtgtggtactctgtgatcatcacagcaggcatggcctacatcttcctgatccagctgatcaacatcagctacaatgtgactgagcgggaagtccagcaggccctccgacagaagactgggcgccggctcctctgcgggctcatcgtggacacagggttacttggatga
Sequence Length
1212
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,983 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 23, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 23
NCBI Official Symbol
ZDHHC23
NCBI Official Synonym Symbols
NIDD; DHHC-23
NCBI Protein Information
palmitoyltransferase ZDHHC23
UniProt Protein Name
Palmitoyltransferase ZDHHC23
Protein Family
UniProt Gene Name
ZDHHC23
UniProt Synonym Gene Names
DHHC-23; zDHHC23
UniProt Entry Name
ZDH23_HUMAN

Uniprot Description

ZDHHC23: May be involved in NOS1 regulation and targeting to the synaptic membrane. Belongs to the DHHC palmitoyltransferase family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Transferase; Adaptor/scaffold; EC 2.3.1.225

Chromosomal Location of Human Ortholog: 3q13.31

Similar Products

Product Notes

The ZDHHC23 zdhhc23 (Catalog #AAA1271800) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcctg tgaagaaaaa gaaaaccgaa gaacctgaat tggagcccct gtgctgctgc gagtacatag atcggaatgg ggaaaagaac cacgtggcta cttgtttgtg tgattgtcaa gatctggatg aagggtgtga tcgatggatt acatgtaaat ctttacagcc agagacttgt gaaagaatca tggatacaat ttctgatcgc ctccgaattc cttggcttag gggagccaaa aaagtgaaca tcagcatcat ccctccgctt gtcctgctgc ctgtcttcct tcatgtggct tcctggcatt tcctcctggg ggtggtggtt ttgacctccc ttcctgtgct ggcactgtgg tactactacc tcactaacag aaggaaagaa cagaccctgt ttttcctgag ccttggactg ttctctctgg gctacatgta ctatgtgttc ctgcaggaag tggtccccaa agggcgtgtg ggtcccgttc agctggcggt tcttacctgc gggttatttc tgatactctt agccttgcac agagccaaga agaatccagg ctacctcagc aatccagcaa gcggtgacag atctctaagc agcagccagc tggagtgcct gagcagaaaa gggcaggaga aggccaaagg gttccctggg gcagacatgt cgggcagtct caacaatcgc acaacaaagg atgaccccaa gggctcttcc aagatgccag ctggaagccc caccaaagcg aaggaggact ggtgtgccaa gtgccagctg gtgcgaccag cccgggcatg gcgctgccgg atatgtggca tctgtgtgag gagaatggat catcattgtg tctggataaa tagctgcgtt ggagaatcaa atcatcaagc atttatactt gcccttttga tcttcttgct cacctcggtg tatgggatca cactgacctt ggacaccatt tgtagagaca gaagtgtctt cacagctctt ttctattgtc ctggagttta tgcaaattac agctcggctc tgtccttcac ctgcgtgtgg tactctgtga tcatcacagc aggcatggcc tacatcttcc tgatccagct gatcaacatc agctacaatg tgactgagcg ggaagtccag caggccctcc gacagaagac tgggcgccgg ctcctctgcg ggctcatcgt ggacacaggg ttacttggat ga. It is sometimes possible for the material contained within the vial of "ZDHHC23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.