WDR85 cdna clone
WDR85 cDNA Clone
Gene Names
DPH7; RRT2; WDR85; C9orf112
Synonyms
WDR85; WDR85 cDNA Clone; WDR85 cdna clone
Sequence
atgatgggctgtttcgccctgcaaacggtggacaccgagctgaccgcggactcggtggagtggtgcccgctgcaaggctgcaggcacctgctggcgtgcgggacctaccagctgcggcggccggaggaccggcctgccggcccccagaacaagggtggaatggaagttaaggagcctcaggtccgtttaggccgtctcttcctgtacagtttcaatgacaacaactctattcaccctctggtcgaggtccaaagaaaagatacttctgcaatcctggacatgaaatggtgtcacatcccggtggctggacatgccctcttgggcttggcagatgccagtggatccatacaactgctccgcctggtggaatctgagaagagccacgtgctggagccattgtccagccttgccctggaggagcagtgtctggctttgtccctagattggtccactgggaaaactggaagggccggggaccagcccttgaagatcatcagcagtgactccacagggcagctccacctcctgatggtgaatgagacgaggcccaggctgcagaaagtggcctcatggcaggcacatcaattcgaggcctggattgctgctttcaattactggcatccagaaattgtgtattcagggggcgacgatggccttctgaggggctgggacaccagggtacccggcaaatttctcttcaccagcaaaagacacaccatgggtgtgtgcagcatccagagcagccctcatcgggagcacatcctggccacgggaagctatgatgaacacatcctactgtgggacacacgaaacatgaagcagccgttggcagatacgcctgtgcagggtggggtatggagaatcaagtggcaccctttccaccaccacctgctcctggccgcctgcatgcacagtggctttaagatcctcaactgccaaaaggcaatggaggagaggcaggaggcgacggtcctgacatctcacacattgcccgactcgctggtgtatggagccgactggtcctggctgctcttccgttctctgcagcgggccccctcgtggtcctttcctagcaacctaggaaccaagacggcagacctgaagggtgcaagcgagttgccaacaccctgtcatgaatgcagagaggataacgatggggagggccatgccagaccccagagtggaatgaagccactcacagagggcatgaggaagaatggcacctggctgcaggctacagcagccaccacacgtgactgtggcgtgaacccagaagaagcagactcagccttcagcctcctggccacctgctccttctatgaccatgcgctccacctctgggagtgggaggggaactga
Sequence Length
1359
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,575 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 85, mRNA
NCBI Official Synonym Full Names
diphthamide biosynthesis 7
NCBI Official Symbol
DPH7
NCBI Official Synonym Symbols
RRT2; WDR85; C9orf112
NCBI Protein Information
diphthine methyltransferase
UniProt Protein Name
Diphthine methyltransferase
Protein Family
UniProt Gene Name
DPH7
UniProt Synonym Gene Names
C9orf112; WDR85
UniProt Entry Name
DPH7_HUMAN
NCBI Description
WDR85 is a WD repeat-containing protein that plays a role in the first step of diphthamide biosynthesis (Carette et al., 2009 [PubMed 19965467]).[supplied by OMIM, Feb 2010]
Uniprot Description
WDR85: Plays a role in the first step of diphthamide biosynthesis, a post-translational modification of histidine which occurs in translation elongation factor 2 which can be ADP- ribosylated by diphtheria toxin and by Pseudomonas exotoxin A. Belongs to the WD repeat WDR85 family.
Chromosomal Location of Human Ortholog: 9q34.3
Biological Process: peptidyl-diphthamide biosynthetic process from peptidyl-histidine
Research Articles on WDR85
Similar Products
Product Notes
The WDR85 dph7 (Catalog #AAA1274748) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgggct gtttcgccct gcaaacggtg gacaccgagc tgaccgcgga ctcggtggag tggtgcccgc tgcaaggctg caggcacctg ctggcgtgcg ggacctacca gctgcggcgg ccggaggacc ggcctgccgg cccccagaac aagggtggaa tggaagttaa ggagcctcag gtccgtttag gccgtctctt cctgtacagt ttcaatgaca acaactctat tcaccctctg gtcgaggtcc aaagaaaaga tacttctgca atcctggaca tgaaatggtg tcacatcccg gtggctggac atgccctctt gggcttggca gatgccagtg gatccataca actgctccgc ctggtggaat ctgagaagag ccacgtgctg gagccattgt ccagccttgc cctggaggag cagtgtctgg ctttgtccct agattggtcc actgggaaaa ctggaagggc cggggaccag cccttgaaga tcatcagcag tgactccaca gggcagctcc acctcctgat ggtgaatgag acgaggccca ggctgcagaa agtggcctca tggcaggcac atcaattcga ggcctggatt gctgctttca attactggca tccagaaatt gtgtattcag ggggcgacga tggccttctg aggggctggg acaccagggt acccggcaaa tttctcttca ccagcaaaag acacaccatg ggtgtgtgca gcatccagag cagccctcat cgggagcaca tcctggccac gggaagctat gatgaacaca tcctactgtg ggacacacga aacatgaagc agccgttggc agatacgcct gtgcagggtg gggtatggag aatcaagtgg caccctttcc accaccacct gctcctggcc gcctgcatgc acagtggctt taagatcctc aactgccaaa aggcaatgga ggagaggcag gaggcgacgg tcctgacatc tcacacattg cccgactcgc tggtgtatgg agccgactgg tcctggctgc tcttccgttc tctgcagcgg gccccctcgt ggtcctttcc tagcaaccta ggaaccaaga cggcagacct gaagggtgca agcgagttgc caacaccctg tcatgaatgc agagaggata acgatgggga gggccatgcc agaccccaga gtggaatgaa gccactcaca gagggcatga ggaagaatgg cacctggctg caggctacag cagccaccac acgtgactgt ggcgtgaacc cagaagaagc agactcagcc ttcagcctcc tggccacctg ctccttctat gaccatgcgc tccacctctg ggagtgggag gggaactga. It is sometimes possible for the material contained within the vial of "WDR85, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
