Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR77 cdna clone

WDR77 cDNA Clone

Synonyms
WDR77; WDR77 cDNA Clone; WDR77 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggaaggaaaccccaccccccctagtgcccccggcggcccgggagtggaatcttcccccaaatgcgcccgcctgcatggaacggcagttggaggctgcgcggtaccggtccgatggggcgcttctcctcggggcctccagcctgagtgggcgctgctgggccggctccctctggctttttaaggacccctgtgccgcccccaacgaaggcttctgctccgccggagtccaaacggaggctggagtggctgacctcacttgggttggggagagaggtattctagtggcctccgattcaggtgctgttgaattgtgggaactagatgagaatgagacacttattgtcagcaagttctgcaagtatgagcatgatgacattgtgtctacagtcagtgtcttgagctctggcacacaagctgtcagtggtagcaaagacatctgcatcaaggtttgggaccttgctcagcaggtggtactgagttcataccgagctcatgctgctcaggtcacttgtgttgctgcctctcctcacaaggactctgtgtttctttcatgcagcgaggacaatagaattttactctgggatacccgctgtcccaagccagcatcacagattggctgcagtgcgcctggctaccttcctacctcgctggcttggcatcctcagcaaagtgaagtctttgtctttggtgatgagaatgggacagtctcccttgtggacaccaagagtacaagctgtgtcctgagctcagctgtacactcccagtgtgtcactgggctggtgttctccccacacagtgttcccttcctggcctctctcagtgaagactgctcacttgctgtgctggactcaagcctttctgagttgtttagaagccaagcccacagagactttgtgagagatgcgacttggtccccgctcaatcactccctggacctgcaagtgttactgagtagattggatttaagacaaaaagcaagtcccccatga
Sequence Length
993
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,651 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 77, mRNA
UniProt Protein Name
Methylosome protein 50
Protein Family
UniProt Gene Name
WDR77
UniProt Synonym Gene Names
MEP50; WD45; MEP-50
UniProt Entry Name
MEP50_HUMAN

Uniprot Description

WDR77: a WD40 repeat protein. Component of the methylosome, a 20S complex containing at least ICLN, SKB1 and WDR77. Interacts with SKB1 and with SM proteins. The methylosome may regulate an early step in the assembly of U snRNPs, possibly the transfer of Sm proteins to the SMN-complex. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.

Protein type: Adaptor/scaffold; Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 1p13.2

Cellular Component: cytoplasm; cytosol; Golgi apparatus; nucleoplasm; nucleus

Molecular Function: ligand-dependent nuclear receptor transcription coactivator activity; methyl-CpG binding; protein binding; protein-arginine N-methyltransferase activity

Biological Process: spliceosomal snRNP biogenesis

Similar Products

Product Notes

The WDR77 wdr77 (Catalog #AAA1267348) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggaagg aaaccccacc ccccctagtg cccccggcgg cccgggagtg gaatcttccc ccaaatgcgc ccgcctgcat ggaacggcag ttggaggctg cgcggtaccg gtccgatggg gcgcttctcc tcggggcctc cagcctgagt gggcgctgct gggccggctc cctctggctt tttaaggacc cctgtgccgc ccccaacgaa ggcttctgct ccgccggagt ccaaacggag gctggagtgg ctgacctcac ttgggttggg gagagaggta ttctagtggc ctccgattca ggtgctgttg aattgtggga actagatgag aatgagacac ttattgtcag caagttctgc aagtatgagc atgatgacat tgtgtctaca gtcagtgtct tgagctctgg cacacaagct gtcagtggta gcaaagacat ctgcatcaag gtttgggacc ttgctcagca ggtggtactg agttcatacc gagctcatgc tgctcaggtc acttgtgttg ctgcctctcc tcacaaggac tctgtgtttc tttcatgcag cgaggacaat agaattttac tctgggatac ccgctgtccc aagccagcat cacagattgg ctgcagtgcg cctggctacc ttcctacctc gctggcttgg catcctcagc aaagtgaagt ctttgtcttt ggtgatgaga atgggacagt ctcccttgtg gacaccaaga gtacaagctg tgtcctgagc tcagctgtac actcccagtg tgtcactggg ctggtgttct ccccacacag tgttcccttc ctggcctctc tcagtgaaga ctgctcactt gctgtgctgg actcaagcct ttctgagttg tttagaagcc aagcccacag agactttgtg agagatgcga cttggtcccc gctcaatcac tccctggacc tgcaagtgtt actgagtaga ttggatttaa gacaaaaagc aagtccccca tga. It is sometimes possible for the material contained within the vial of "WDR77, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.