Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR45L cdna clone

WDR45L cDNA Clone

Gene Names
WDR45B; WIPI3; WDR45L; WIPI-3
Synonyms
WDR45L; WDR45L cDNA Clone; WDR45L cdna clone
Ordering
For Research Use Only!
Sequence
atgttatttcgctgcaactatttagctttagttggtggtggaaaaaagccgaaataccctcccaacaaagtaatgatctgggatgacctgaagaagaagactgttattgaaatagaattttctacagaagtcaaggcagtcaaactgcggcgagatagaattgtggtggttttggactccatgattaaggtgttcacattcacacacaatccccatcagttgcacgtcttcgaaacctgctataaccccaaaggcctctgtgtcctttgtcccaatagtaacaactccctcctggcctttccgggcacgcacacgggccatgtgcagcttgtggacctggccagcacggagaagccacccgtggacattcctgcacacgagggtgtcctgagctgcattgcactcaacctgcagggaacaagaattgcaactgcatccgagaaagggacgcttataagaatatttgatacttcatcagggcatttaatccaggaactgcgaagaggatctcaagcagccaatatttactgcatcaacttcaatcaggatgcgtccctcatctgcgtatccagcgaccacggcacagtgcatatttttgcagctgaagatccaaaaaggaataaacagtccagtttggcctcagccagtttccttccaaaatacttcagttccaagtggagtttctccaagtttcaggttccctcaggctctccgtgcatttgtgcctttggaacagagccaaacgccgtcattgcaatttgtgcagacggcagctactacaaattcctgttcaaccccaagggggagtgcatccgagatgtctacgcgcagtttctagagatgaccgatgacaagctgtga
Sequence Length
861
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,122 Da
NCBI Official Full Name
Homo sapiens WDR45-like, mRNA
NCBI Official Synonym Full Names
WD repeat domain 45B
NCBI Official Symbol
WDR45B
NCBI Official Synonym Symbols
WIPI3; WDR45L; WIPI-3
NCBI Protein Information
WD repeat domain phosphoinositide-interacting protein 3
UniProt Protein Name
WD repeat domain phosphoinositide-interacting protein 3
UniProt Gene Name
WDR45B
UniProt Synonym Gene Names
WDR45L; WIPI3; WIPI-3; WDR45-like protein
UniProt Entry Name
WIPI3_HUMAN

NCBI Description

This gene encodes a member of the WIPI or SVP1 family of WD40 repeat-containing proteins. The protein contains seven WD40 repeats that are thought to fold into a beta-propeller structure that mediates protein-protein interactions, and a conserved motif for interaction with phospholipids. The human genome contains several pseudogenes of this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

WDR45B: an ubiquitously expressed WD40 repeat protein. Up-regulated in a variety of tumor tissues including ovarian and uterine cancers. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytosol; extrinsic to membrane; pre-autophagosomal structure membrane

Molecular Function: phosphatidylinositol 3-phosphate binding

Biological Process: autophagic vacuole formation; mitochondrion degradation; protein amino acid lipidation

Similar Products

Product Notes

The WDR45L wdr45b (Catalog #AAA1268101) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttatttc gctgcaacta tttagcttta gttggtggtg gaaaaaagcc gaaataccct cccaacaaag taatgatctg ggatgacctg aagaagaaga ctgttattga aatagaattt tctacagaag tcaaggcagt caaactgcgg cgagatagaa ttgtggtggt tttggactcc atgattaagg tgttcacatt cacacacaat ccccatcagt tgcacgtctt cgaaacctgc tataacccca aaggcctctg tgtcctttgt cccaatagta acaactccct cctggccttt ccgggcacgc acacgggcca tgtgcagctt gtggacctgg ccagcacgga gaagccaccc gtggacattc ctgcacacga gggtgtcctg agctgcattg cactcaacct gcagggaaca agaattgcaa ctgcatccga gaaagggacg cttataagaa tatttgatac ttcatcaggg catttaatcc aggaactgcg aagaggatct caagcagcca atatttactg catcaacttc aatcaggatg cgtccctcat ctgcgtatcc agcgaccacg gcacagtgca tatttttgca gctgaagatc caaaaaggaa taaacagtcc agtttggcct cagccagttt ccttccaaaa tacttcagtt ccaagtggag tttctccaag tttcaggttc cctcaggctc tccgtgcatt tgtgcctttg gaacagagcc aaacgccgtc attgcaattt gtgcagacgg cagctactac aaattcctgt tcaaccccaa gggggagtgc atccgagatg tctacgcgca gtttctagag atgaccgatg acaagctgtg a. It is sometimes possible for the material contained within the vial of "WDR45L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.