Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR34 cdna clone

WDR34 cDNA Clone

Gene Names
WDR34; DIC5; FAP133; SRTD11; bA216B9.3
Synonyms
WDR34; WDR34 cDNA Clone; WDR34 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcatccgagagctgaacaagaattggcagagccacgcgtttgatggcttcgaggtgaactggaccgagcagcagcagatggtgtcttgtctgtataccctgggctacccgccagcccaagcgcagggtctgcatgtgaccagcatctcctggaactccactggctctgtggtggcctgtgcctacggccggctggaccatggggactggagcacgcttaagtccttcgtgtgtgcctggaacctggaccggcgagacctgcgtccccagcaaccgtcggccgtggtggaggtccccagcgctgtcctgtgtctggccttccaccccacgcagccctcccacgtcgcaggagggctgtacagtggtgaggtgttggtgtgggacctgagccgtcttgaggacccgctgctgtggcgcacaggcctgacggatgacacccacacagaccctgtgtcccaggtggtgtggctgcccgagcctgggcacagccaccgcttccaggtgctgagtgtggccactgacgggaaggtgctactctggcagggcatcggggtaggccagctgcagctcacagagggcttcgccctggtcatgcagcagctgccacggagcaccaagctcaagaagcatccccgcggggagaccgaggtgggcgccacggcagtggccttctccagctttgaccctaggctgttcattctgggcacggaaagcggcttcccgctcaagtgttccctggcagctggagaggcagccctcacgcggatgcccagctccgtgcccctgcgggccccagcacagtttaccttctccccccacggcggtcccatctactctgtgagctgttcccccttccacaggaatctcttcctgagcgctgggactgacgggcatgtccacctgtactccatgctgcaggcccctcccttgacttcgctgcagctctccctcaagtatctgtttgctgtgcgctggtccccagtgcggcccttggtttttgcagctgcctctgggaaaggtgacgtgcagctgtttgatctccagaaaagctcccagaaacccacagttttgatcaagcaaacccaggatgaaagccctgtctactgtctggagttcaacagccagcagactcagctcttggctgcgggcgatgcccagggcacagtgaaggtgtggcagctgagcacagagttcacggaacaagggccccgggaagctgaggacctggactgcctggcagcagaggtggcggcctga
Sequence Length
1260
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,801 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 34, mRNA
NCBI Official Synonym Full Names
WD repeat domain 34
NCBI Official Symbol
WDR34
NCBI Official Synonym Symbols
DIC5; FAP133; SRTD11; bA216B9.3
NCBI Protein Information
WD repeat-containing protein 34
UniProt Protein Name
WD repeat-containing protein 34
UniProt Gene Name
WDR34
UniProt Entry Name
WDR34_HUMAN

NCBI Description

This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Defects in this gene are a cause of short-rib thoracic dysplasia 11 with or without polydactyly. [provided by RefSeq, Mar 2014]

Uniprot Description

WDR34: Acts as a negative regulator of the Toll-like and IL-1R receptor signaling pathways. Inhibits the MAP3K7-induced NF-kappa- B activation pathway. Inhibits MAP3K7 phosphorylation at 'Thr-184' and 'Thr-187' upon Il-1 beta stimulation.

Chromosomal Location of Human Ortholog: 9q34.11

Cellular Component: axoneme; centriole; cytoplasm

Molecular Function: protein binding

Disease: Short-rib Thoracic Dysplasia 11 With Or Without Polydactyly

Research Articles on WDR34

Similar Products

Product Notes

The WDR34 wdr34 (Catalog #AAA1269761) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcatcc gagagctgaa caagaattgg cagagccacg cgtttgatgg cttcgaggtg aactggaccg agcagcagca gatggtgtct tgtctgtata ccctgggcta cccgccagcc caagcgcagg gtctgcatgt gaccagcatc tcctggaact ccactggctc tgtggtggcc tgtgcctacg gccggctgga ccatggggac tggagcacgc ttaagtcctt cgtgtgtgcc tggaacctgg accggcgaga cctgcgtccc cagcaaccgt cggccgtggt ggaggtcccc agcgctgtcc tgtgtctggc cttccacccc acgcagccct cccacgtcgc aggagggctg tacagtggtg aggtgttggt gtgggacctg agccgtcttg aggacccgct gctgtggcgc acaggcctga cggatgacac ccacacagac cctgtgtccc aggtggtgtg gctgcccgag cctgggcaca gccaccgctt ccaggtgctg agtgtggcca ctgacgggaa ggtgctactc tggcagggca tcggggtagg ccagctgcag ctcacagagg gcttcgccct ggtcatgcag cagctgccac ggagcaccaa gctcaagaag catccccgcg gggagaccga ggtgggcgcc acggcagtgg ccttctccag ctttgaccct aggctgttca ttctgggcac ggaaagcggc ttcccgctca agtgttccct ggcagctgga gaggcagccc tcacgcggat gcccagctcc gtgcccctgc gggccccagc acagtttacc ttctcccccc acggcggtcc catctactct gtgagctgtt cccccttcca caggaatctc ttcctgagcg ctgggactga cgggcatgtc cacctgtact ccatgctgca ggcccctccc ttgacttcgc tgcagctctc cctcaagtat ctgtttgctg tgcgctggtc cccagtgcgg cccttggttt ttgcagctgc ctctgggaaa ggtgacgtgc agctgtttga tctccagaaa agctcccaga aacccacagt tttgatcaag caaacccagg atgaaagccc tgtctactgt ctggagttca acagccagca gactcagctc ttggctgcgg gcgatgccca gggcacagtg aaggtgtggc agctgagcac agagttcacg gaacaagggc cccgggaagc tgaggacctg gactgcctgg cagcagaggt ggcggcctga. It is sometimes possible for the material contained within the vial of "WDR34, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.