Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDFY2 cdna clone

WDFY2 cDNA Clone

Gene Names
WDFY2; PROF; WDF2; ZFYVE22
Synonyms
WDFY2; WDFY2 cDNA Clone; WDFY2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggagatccagcccaagcctctgacccgcaagccgatcctgctgcagcggatggaggggtcccaggaggtggtgaatatggccgtgatcgtgcccaaagaggagggcgtcatcagcgtctccgaggacaggacagttcgtgtttggttaaagagagacagtggacagtattggccaagcgtataccatgcaatgccttctccatgttcatgcatgtcttttaacccggaaacaagaagactgtccataggtctagacaatggtacaatctcagagtttatattgtcagaagattataacaagatgactcctgtgaaaaactatcaagcgcatcagagcagagtgacgatgatcctgtttgtcctggagctggagtgggtgctgagcacaggacaggacaagcaatttgcctggcactgctctgagagtgggcagcgcctgggaggttatcggaccagtgctgtggcctcaggcctgcaatttgatgttgaaacccggcatgtgtttatcggtgaccactcaggccaagtaacaatcctcaaactggagcaagaaaactgcaccctggtcacaacattcagaggacacacaggtggggtgaccgctctctgttgggacccagtccagcgggtgttgttctcaggcagttcagatcactctgtcatcatgtgggacatcggtgggagaaaaggaacagccatcgagctccaaggacacaacgacagagtccaggccctctcctatgcacagcacacgcgacaattgatctcctgtggcggtgatggtgggattgtcgtctggaacatggacgtggagaggcaggagacccctgaatggttggacagtgattcctgccaaaagtgtgatcagcctttcttctggaacttcaagcaaatgtgggacagtaagaaaattggtctaagacagcaccactgccgcaagtgtgggaaggccgtctgtggcaagtgcagctccaagcgctcctccatccccctgatgggcttcgagtttgaagtgagggtctgtgacagctgccacgaggccatcacagatgaagaacgtgcacccacagccaccttccatgacagtaaacataacattgtgcatgtgcatttcgatgcaaccagaggatggttactgacttctggaactgacaaggttattaagttgtgggatatgaccccagtcgtgtcttga
Sequence Length
1203
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,154 Da
NCBI Official Full Name
Homo sapiens WD repeat and FYVE domain containing 2, mRNA
NCBI Official Synonym Full Names
WD repeat and FYVE domain containing 2
NCBI Official Symbol
WDFY2
NCBI Official Synonym Symbols
PROF; WDF2; ZFYVE22
NCBI Protein Information
WD repeat and FYVE domain-containing protein 2
UniProt Protein Name
WD repeat and FYVE domain-containing protein 2
UniProt Gene Name
WDFY2
UniProt Synonym Gene Names
WDF2; ZFYVE22; Prof
UniProt Entry Name
WDFY2_HUMAN

NCBI Description

This gene encodes a protein that contains two WD domains and an FYVE zinc finger region. The function of this gene is unknown. An alternatively spliced transcript variant of this gene may exist. [provided by RefSeq, Jul 2008]

Uniprot Description

WDFY2: Acts in an adapter protein-like fashion to mediate the interaction between the kinase PRKCZ and its substrate VAMP2 and increases the PRKCZ-dependent phosphorylation of VAMP2 (PubMed:17313651). Positively regulates adipocyte differentiation, by facilitating the phosphorylation and thus inactivation of the anti-adipogenetic transcription factor FOXO1 by the kinase AKT1 (PubMed:18388859). Plays a role in endosomal control of AKT2 signaling; required for insulin-stimulated AKT2 phosphorylation and glucose uptake and insulin-stimulated phosphorylation of AKT2 substrates. Participates in transferrin receptor endocytosis (PubMed:16873553). {ECO:0000250|UniProtKB:Q8BUB4, ECO:0000269|PubMed:16873553, ECO:0000269|PubMed:17313651, ECO:0000269|PubMed:18388859}. Homodimer (PubMed:16792529). Interacts (via WD repeats 1- 3) with AKT1, AKT2, PRKCZ and PRKCI (PubMed:16792529). Interacts with VAMP2 (PubMed:17313651). Forms a complex with VAMP2 and PRKCZ (PubMed:17313651). Interacts with FOXO1. Forms a complex with AKT1 and FOXO1. {ECO:0000250|UniProtKB:Q8BUB4, ECO:0000269|PubMed:16792529, ECO:0000269|PubMed:17313651}

Chromosomal Location of Human Ortholog: 13q14.3

Cellular Component: early endosome; vesicle

Molecular Function: protein binding

Biological Process: positive regulation of fat cell differentiation; positive regulation of protein amino acid phosphorylation

Research Articles on WDFY2

Similar Products

Product Notes

The WDFY2 wdfy2 (Catalog #AAA1276857) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg agatccagcc caagcctctg acccgcaagc cgatcctgct gcagcggatg gaggggtccc aggaggtggt gaatatggcc gtgatcgtgc ccaaagagga gggcgtcatc agcgtctccg aggacaggac agttcgtgtt tggttaaaga gagacagtgg acagtattgg ccaagcgtat accatgcaat gccttctcca tgttcatgca tgtcttttaa cccggaaaca agaagactgt ccataggtct agacaatggt acaatctcag agtttatatt gtcagaagat tataacaaga tgactcctgt gaaaaactat caagcgcatc agagcagagt gacgatgatc ctgtttgtcc tggagctgga gtgggtgctg agcacaggac aggacaagca atttgcctgg cactgctctg agagtgggca gcgcctggga ggttatcgga ccagtgctgt ggcctcaggc ctgcaatttg atgttgaaac ccggcatgtg tttatcggtg accactcagg ccaagtaaca atcctcaaac tggagcaaga aaactgcacc ctggtcacaa cattcagagg acacacaggt ggggtgaccg ctctctgttg ggacccagtc cagcgggtgt tgttctcagg cagttcagat cactctgtca tcatgtggga catcggtggg agaaaaggaa cagccatcga gctccaagga cacaacgaca gagtccaggc cctctcctat gcacagcaca cgcgacaatt gatctcctgt ggcggtgatg gtgggattgt cgtctggaac atggacgtgg agaggcagga gacccctgaa tggttggaca gtgattcctg ccaaaagtgt gatcagcctt tcttctggaa cttcaagcaa atgtgggaca gtaagaaaat tggtctaaga cagcaccact gccgcaagtg tgggaaggcc gtctgtggca agtgcagctc caagcgctcc tccatccccc tgatgggctt cgagtttgaa gtgagggtct gtgacagctg ccacgaggcc atcacagatg aagaacgtgc acccacagcc accttccatg acagtaaaca taacattgtg catgtgcatt tcgatgcaac cagaggatgg ttactgactt ctggaactga caaggttatt aagttgtggg atatgacccc agtcgtgtct tga. It is sometimes possible for the material contained within the vial of "WDFY2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.