VARS2 cdna clone
VARS2 cDNA Clone
Gene Names
VARS2; VALRS; VARSL; VARS2L; COXPD20
Synonyms
VARS2; VARS2 cDNA Clone; VARS2 cdna clone
Sequence
atgacctccctctgcggggactggttgcagggtcttcaccggtttgtggcccgggaaaagataatgtctgtgctgagtgaacggggcctattccggggcctccagaaccaccccatggtactgcccatctgcagccgttctggggatgtgatagaatacctgctgaagaaccagtggtttgtccgctgccaggaaatgggggcccgagctgccaaggctgtggagtcgggggccctggagctcagtccctccttccaccagaagaactggcagcactggttttcccatattggggactggtgtgtctcccggcagctgtggtggggccatcagattccagcctacctggttgtagaggaccatgcgcagggagaagaggactgttgggtggttgggcggtcagaggctgaggccagagaggtagcagcggaactgacagggaggccaggggcagagctgaccctggagagggatcctgatgtcctagacacatggttttcttctgccctgttccccttttctgccctgggctggccccaagagaccccagaccttgctcgtttctaccccctgtcacttttggaaacgggcagcgaccttctgctgttctgggtgggccgcatggtcatgttggggacccagctcacagggcagctgcccttcagcaaggtgcttcttcatcccatggttcgggacaggcagggccggaagatgagcaagtccctggggaatgtgctggacccaagagacatcatcagtggggtggagatgcagttgctgcaggaaaagctgagaagcggaaatttggaccctgcagagctggccattgtggctgcagcacagaaaaaggactttcctcacgggatccctgagtgtgggacagatgccctgagattcacactctgctcccatggagttcaggcgggcgacttgcacctgtcagtctctgaggtccagagctgccgacatttctgcaacaagatctggaatgctcttcgctttatcctcaatgctttaggggagaaatttgtgccacagcctgctgaggagctgtctccctcctccccgatggatgcctggatcctgagccgccttgccctggctgcccaggagtgtgagcggggcttcctcacccgagagctctcgctcgtcactcatgccctgcaccacttctggcttcacaacctctgtgacgtctacctggaggctgtgaagcccgtgctgtggcactcgccccgccccctggggccccctcaggtcctgttctcctgcgctgacctcggcctccgcctcctggccccactgatgcccttcctggctgaagagctctggcagaggctgccccccaggcctggttgcccccctgcccccagcatctcggttgccccctaccctagcgcctgcagcttggagcactggcgccagccagagctggagcggcgcttctcccgggtccaagaggtcgtgcaggtgctaagggctctccgagccacgtaccagctcaccaaagcccggccccgagtgctgctgcagagctcagagcctggggaccagggcctcttcgaggccttcttggagcccctgggcaccctgggctactgtggggctgtgggcctgttacccccaggcacagcagctccctccggctgggcccaggctccactcagtgacacggctcaagtctacatggagctgcagggcctggtggacccgcagatccagctacctctgttagccgcccgaaggtacaagttgcagaagcagcttgatagcctcacagccaggaccccatcagaaggggaggcagggactcagaggcaacaaaagctttcttccctccagctggaattgtcaaaactggacaaggcagcctctcacctccggcagctgatggatgagcctccagccccagggagcccggagctctaa
Sequence Length
1929
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
121,543 Da
NCBI Official Full Name
Homo sapiens valyl-tRNA synthetase 2, mitochondrial (putative), mRNA
NCBI Official Synonym Full Names
valyl-tRNA synthetase 2, mitochondrial
NCBI Official Symbol
VARS2
NCBI Official Synonym Symbols
VALRS; VARSL; VARS2L; COXPD20
NCBI Protein Information
valine--tRNA ligase, mitochondrial
UniProt Protein Name
Valine--tRNA ligase, mitochondrial
UniProt Gene Name
VARS2
UniProt Synonym Gene Names
KIAA1885; VARS2L; VARSL; ValRS
UniProt Entry Name
SYVM_HUMAN
NCBI Description
This gene encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Uniprot Description
VARS2: Belongs to the class-I aminoacyl-tRNA synthetase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 6.1.1.9; Ligase; Amino Acid Metabolism - valine, leucine and isoleucine biosynthesis; Translation
Chromosomal Location of Human Ortholog: 6p21.33
Cellular Component: cytosol
Molecular Function: valine-tRNA ligase activity
Biological Process: valyl-tRNA aminoacylation
Disease: Combined Oxidative Phosphorylation Deficiency 20
Research Articles on VARS2
Similar Products
Product Notes
The VARS2 vars2 (Catalog #AAA1273722) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctccc tctgcgggga ctggttgcag ggtcttcacc ggtttgtggc ccgggaaaag ataatgtctg tgctgagtga acggggccta ttccggggcc tccagaacca ccccatggta ctgcccatct gcagccgttc tggggatgtg atagaatacc tgctgaagaa ccagtggttt gtccgctgcc aggaaatggg ggcccgagct gccaaggctg tggagtcggg ggccctggag ctcagtccct ccttccacca gaagaactgg cagcactggt tttcccatat tggggactgg tgtgtctccc ggcagctgtg gtggggccat cagattccag cctacctggt tgtagaggac catgcgcagg gagaagagga ctgttgggtg gttgggcggt cagaggctga ggccagagag gtagcagcgg aactgacagg gaggccaggg gcagagctga ccctggagag ggatcctgat gtcctagaca catggttttc ttctgccctg ttcccctttt ctgccctggg ctggccccaa gagaccccag accttgctcg tttctacccc ctgtcacttt tggaaacggg cagcgacctt ctgctgttct gggtgggccg catggtcatg ttggggaccc agctcacagg gcagctgccc ttcagcaagg tgcttcttca tcccatggtt cgggacaggc agggccggaa gatgagcaag tccctgggga atgtgctgga cccaagagac atcatcagtg gggtggagat gcagttgctg caggaaaagc tgagaagcgg aaatttggac cctgcagagc tggccattgt ggctgcagca cagaaaaagg actttcctca cgggatccct gagtgtggga cagatgccct gagattcaca ctctgctccc atggagttca ggcgggcgac ttgcacctgt cagtctctga ggtccagagc tgccgacatt tctgcaacaa gatctggaat gctcttcgct ttatcctcaa tgctttaggg gagaaatttg tgccacagcc tgctgaggag ctgtctccct cctccccgat ggatgcctgg atcctgagcc gccttgccct ggctgcccag gagtgtgagc ggggcttcct cacccgagag ctctcgctcg tcactcatgc cctgcaccac ttctggcttc acaacctctg tgacgtctac ctggaggctg tgaagcccgt gctgtggcac tcgccccgcc ccctggggcc ccctcaggtc ctgttctcct gcgctgacct cggcctccgc ctcctggccc cactgatgcc cttcctggct gaagagctct ggcagaggct gccccccagg cctggttgcc cccctgcccc cagcatctcg gttgccccct accctagcgc ctgcagcttg gagcactggc gccagccaga gctggagcgg cgcttctccc gggtccaaga ggtcgtgcag gtgctaaggg ctctccgagc cacgtaccag ctcaccaaag cccggccccg agtgctgctg cagagctcag agcctgggga ccagggcctc ttcgaggcct tcttggagcc cctgggcacc ctgggctact gtggggctgt gggcctgtta cccccaggca cagcagctcc ctccggctgg gcccaggctc cactcagtga cacggctcaa gtctacatgg agctgcaggg cctggtggac ccgcagatcc agctacctct gttagccgcc cgaaggtaca agttgcagaa gcagcttgat agcctcacag ccaggacccc atcagaaggg gaggcaggga ctcagaggca acaaaagctt tcttccctcc agctggaatt gtcaaaactg gacaaggcag cctctcacct ccggcagctg atggatgagc ctccagcccc agggagcccg gagctctaa. It is sometimes possible for the material contained within the vial of "VARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
