Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP37 cdna clone

USP37 cDNA Clone

Synonyms
USP37; USP37 cDNA Clone; USP37 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcctctgaagatacatggtcctatcagaattcgaagtatgcagactgggattacaaagtggaaagaaggatcctttgaaattgtagaaaaagagaataaagtcagcctagtagttcactacaatactggaggaattccaaggatatttcagctaagtcataacattaaaaatgtggtgcttcgacccagtggagcgaaacaaagccgcctaatgttaactctgcaagataacagcttcttgtctattgacaaagtaccaagtaaggatgcagaggaaatgaggttgtttctagatgcagtccatcaaaacagacttcctgcagccatgaaaccgtctcaggggtctggtagttttggagccattctgggcagcaggacctcacagaaggaaaccagcaggcagctttcttactcagacaatcaggcttctgcaaaaagaggaagtttggaaactaaagatgatattccatttcgaaaagttcttggtaatccgggtagaggatcgattaagactgtagcaggaagtggaatagctcggacgattccttctttgacatctacttcaacacctcttagatcagggttgctagaaaatcgtactgaaaagaggaaaagaatgatatcaactggctcagaattgaatgaagattaccctaaggaaaatgattcatcatcgaacaacaaggccatgacagatccctccagaaagtatttaaccagcagtagagaaaagcagctgagtttgaaacagtcagaagagaataggacatcagggcttttacctttacagtcatcatccttttatggtagcagagctggatccaaggaacactcttctggtggcactaacttagacagatttattgggtataaatacataagatacctgctaagcacttgttga
Sequence Length
909
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
99,752 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 37, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 37
NCBI Official Symbol
USP37
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 37
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 37
UniProt Gene Name
USP37
UniProt Synonym Gene Names
KIAA1594
UniProt Entry Name
UBP37_HUMAN

Uniprot Description

USP37: a ubiquitin carboxyl-terminal hydrolase involved in deubiquitination.

Protein type: Ubiquitin conjugating system; Protease; Ubiquitin-specific protease; EC 3.4.19.12

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: nucleus

Molecular Function: cysteine-type endopeptidase activity; protein binding; protein kinase binding; ubiquitin-specific protease activity

Biological Process: G1/S transition of mitotic cell cycle; protein deubiquitination

Research Articles on USP37

Similar Products

Product Notes

The USP37 usp37 (Catalog #AAA1270884) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcctc tgaagataca tggtcctatc agaattcgaa gtatgcagac tgggattaca aagtggaaag aaggatcctt tgaaattgta gaaaaagaga ataaagtcag cctagtagtt cactacaata ctggaggaat tccaaggata tttcagctaa gtcataacat taaaaatgtg gtgcttcgac ccagtggagc gaaacaaagc cgcctaatgt taactctgca agataacagc ttcttgtcta ttgacaaagt accaagtaag gatgcagagg aaatgaggtt gtttctagat gcagtccatc aaaacagact tcctgcagcc atgaaaccgt ctcaggggtc tggtagtttt ggagccattc tgggcagcag gacctcacag aaggaaacca gcaggcagct ttcttactca gacaatcagg cttctgcaaa aagaggaagt ttggaaacta aagatgatat tccatttcga aaagttcttg gtaatccggg tagaggatcg attaagactg tagcaggaag tggaatagct cggacgattc cttctttgac atctacttca acacctctta gatcagggtt gctagaaaat cgtactgaaa agaggaaaag aatgatatca actggctcag aattgaatga agattaccct aaggaaaatg attcatcatc gaacaacaag gccatgacag atccctccag aaagtattta accagcagta gagaaaagca gctgagtttg aaacagtcag aagagaatag gacatcaggg cttttacctt tacagtcatc atccttttat ggtagcagag ctggatccaa ggaacactct tctggtggca ctaacttaga cagatttatt gggtataaat acataagata cctgctaagc acttgttga. It is sometimes possible for the material contained within the vial of "USP37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.