UBR7 cdna clone
UBR7 cDNA Clone
Gene Names
UBR7; C14orf130
Synonyms
UBR7; UBR7 cDNA Clone; UBR7 cdna clone
Sequence
atgatccagtgcgtagtctgtgaagactggttccatggaaggcatcttggtgccattccccctgagagtggggattttcaggagatggtatgccaggcctgcatgaaacgttgttcttttttgtgggcttatgctgcacaattggcagtaaccaaaatatccactgaggatgatggattggtgcggaacattgatggaataggtgatcaggaagttatcaaacctgaaaatggagagcatcaagatagtaccctcaaagaggatgttccagaacagggaaaggatgatgtccgggaggttaaagtagagcagaacagtgaaccatgtgccggctctagttctgaatctgatctccagacagtgtttaagaatgaaagcctcaacgcagaatcaaaatctggctgcaaacttcaggagcttaaagctaagcagcttataaagaaagacactgccacctattggcccctgaactggcgtagcaagttgtgtacctgccaagactgtatgaaaatgtatggagatctagatgtcttattcctgacagatgaatacgacacagttctggcttatgaaaacaaagggaagattgcccaggccactgacaggagcgatcccctaatggatacccttagcagcatgaatagagtccagcaagtggaactcatttgtgaatacaatgatttgaagactgaacttaaagactatctcaagagatttgctgatgaaggcacggttgttaagagagaggacattcagcagttctttgaagagtttcagtcaaaaaagagaagaagagtggatgggatgcagtattactgcagctag
Sequence Length
825
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,999 Da
NCBI Official Full Name
Homo sapiens ubiquitin protein ligase E3 component n-recognin 7 (putative), mRNA
NCBI Official Synonym Full Names
ubiquitin protein ligase E3 component n-recognin 7 (putative)
NCBI Official Symbol
UBR7
NCBI Official Synonym Symbols
C14orf130
NCBI Protein Information
putative E3 ubiquitin-protein ligase UBR7
UniProt Protein Name
Putative E3 ubiquitin-protein ligase UBR7
Protein Family
UniProt Gene Name
UBR7
UniProt Synonym Gene Names
C14orf130
UniProt Entry Name
UBR7_HUMAN
NCBI Description
This gene encodes a UBR box-containing protein that belongs to the E3 ubiquitin ligase family. The protein also contains a plant homeodomain (PHD) in the C-terminus. In mammals, the encoded protein recognizes N-degrons, the destabilizing N-terminal residues of short-lived proteins, which results in ubiquitinylation, and proteolysis via the proteasome. [provided by RefSeq, Jul 2016]
Uniprot Description
UBR7: E3 ubiquitin-protein ligase which is a component of the N-end rule pathway. Recognizes and binds to proteins bearing specific N-terminal residues that are destabilizing according to the N-end rule, leading to their ubiquitination and subsequent degradation.
Protein type: EC 6.3.2.19; EC 6.3.2.-; Ubiquitin conjugating system; Ligase; Ubiquitin ligase
Chromosomal Location of Human Ortholog: 14q32.12
Research Articles on UBR7
Similar Products
Product Notes
The UBR7 ubr7 (Catalog #AAA1271798) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccagt gcgtagtctg tgaagactgg ttccatggaa ggcatcttgg tgccattccc cctgagagtg gggattttca ggagatggta tgccaggcct gcatgaaacg ttgttctttt ttgtgggctt atgctgcaca attggcagta accaaaatat ccactgagga tgatggattg gtgcggaaca ttgatggaat aggtgatcag gaagttatca aacctgaaaa tggagagcat caagatagta ccctcaaaga ggatgttcca gaacagggaa aggatgatgt ccgggaggtt aaagtagagc agaacagtga accatgtgcc ggctctagtt ctgaatctga tctccagaca gtgtttaaga atgaaagcct caacgcagaa tcaaaatctg gctgcaaact tcaggagctt aaagctaagc agcttataaa gaaagacact gccacctatt ggcccctgaa ctggcgtagc aagttgtgta cctgccaaga ctgtatgaaa atgtatggag atctagatgt cttattcctg acagatgaat acgacacagt tctggcttat gaaaacaaag ggaagattgc ccaggccact gacaggagcg atcccctaat ggataccctt agcagcatga atagagtcca gcaagtggaa ctcatttgtg aatacaatga tttgaagact gaacttaaag actatctcaa gagatttgct gatgaaggca cggttgttaa gagagaggac attcagcagt tctttgaaga gtttcagtca aaaaagagaa gaagagtgga tgggatgcag tattactgca gctag. It is sometimes possible for the material contained within the vial of "UBR7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
