Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

U2AF1L4 cdna clone

U2AF1L4 cDNA Clone

Gene Names
U2AF1L4; U2af26; U2AF1L3; U2AF1RS3; U2AF1-RS3; U2AF1L3V1
Synonyms
U2AF1L4; U2AF1L4 cDNA Clone; U2AF1L4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgaatatttagcttcgatattcgggactgagaaggacaaggttaactgctctttttactttaagatcggggtctgccggcacggggaccggtgctcccggcttcacaacaagccgacattcagccaggaggtgttcacagaactgcaggagaagtatggggagattgaagagatgaatgtgtgcgacaaccttggggaccacgtcgtgggcaacgtctatgtcaagttccggagggaggaggatggagagcgggccgtggctgaactcagtaaccgctggttcaacgggcaggctgtgcacgggaatgtacccgaggtggcttctgcaacttcatgcatctgcggcccatttcccagaacctccagaggcagctctatgggcggggacccaggcgcaggtcacccccgaggttccatactggccacaatccccgagagaggaaccatcggtgttcccctgatcactggcatggccgcttctgaggccctggcccccttacccttcacccccaacagggacagatgttcctggcaggacctctcctcaaagcccccttcactctcctgccccatccttcccaggctcccgggctccataatgtaa
Sequence Length
609
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,283 Da
NCBI Official Full Name
Homo sapiens U2 small nuclear RNA auxiliary factor 1-like 4, mRNA
NCBI Official Synonym Full Names
U2 small nuclear RNA auxiliary factor 1 like 4
NCBI Official Symbol
U2AF1L4
NCBI Official Synonym Symbols
U2af26; U2AF1L3; U2AF1RS3; U2AF1-RS3; U2AF1L3V1
NCBI Protein Information
splicing factor U2AF 26 kDa subunit
UniProt Protein Name
Splicing factor U2AF 26 kDa subunit
Protein Family
UniProt Gene Name
U2AF1L4
UniProt Synonym Gene Names
U2AF1-RS3; U2AF1L3; U2 small nuclear RNA auxiliary factor 1-like protein 3; U2AF1-like protein 3
UniProt Entry Name
U2AF4_HUMAN

Uniprot Description

U2AF1L4: RNA-binding protein that function as a pre-mRNA splicing factor. Plays a critical role in both constitutive and enhancer- dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. Acts by enhancing the binding of U2AF2 to weak pyrimidine tracts. Also participates in the regulation of alternative pre-mRNA splicing. Activates exon 5 skipping of PTPRC during T-cell activation; an event reversed by GFI1. Binds to RNA at the AG dinucleotide at the 3'-splice site. Belongs to the splicing factor SR family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing

Chromosomal Location of Human Ortholog: 19q13.12

Research Articles on U2AF1L4

Similar Products

Product Notes

The U2AF1L4 u2af1l4 (Catalog #AAA1278793) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgaat atttagcttc gatattcggg actgagaagg acaaggttaa ctgctctttt tactttaaga tcggggtctg ccggcacggg gaccggtgct cccggcttca caacaagccg acattcagcc aggaggtgtt cacagaactg caggagaagt atggggagat tgaagagatg aatgtgtgcg acaaccttgg ggaccacgtc gtgggcaacg tctatgtcaa gttccggagg gaggaggatg gagagcgggc cgtggctgaa ctcagtaacc gctggttcaa cgggcaggct gtgcacggga atgtacccga ggtggcttct gcaacttcat gcatctgcgg cccatttccc agaacctcca gaggcagctc tatgggcggg gacccaggcg caggtcaccc ccgaggttcc atactggcca caatccccga gagaggaacc atcggtgttc ccctgatcac tggcatggcc gcttctgagg ccctggcccc cttacccttc acccccaaca gggacagatg ttcctggcag gacctctcct caaagccccc ttcactctcc tgccccatcc ttcccaggct cccgggctcc ataatgtaa. It is sometimes possible for the material contained within the vial of "U2AF1L4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.