Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TXNDC12 cdna clone

TXNDC12 cDNA Clone

Gene Names
TXNDC12; AG1; AGR1; ERP16; ERP18; ERP19; TLP19; hAG-1; PDIA16; hTLP19
Synonyms
TXNDC12; TXNDC12 cDNA Clone; TXNDC12 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacgcggcctcgtctcggggccacctgtttgctgggcttcagtttcctgctcctcgtcatctcttctgatggacataatgggcttggaaagggttttggagatcatattcattggaggacactggaagatgggaagaaagaagcagctgccagtggactgcccctgatggtgattattcataaatcctggtgtggagcttgcaaagctctaaagcccaaatttgcagaatctacggaaatttcagaactctcccataattttgttatggtaaatcttgaggatgaagaggaacccaaacatgaagatttcagccctgacgggggttatattccacgaatcctttttctggatcccagtggcaaggtgcatcctgaaatcatcaatgagaatggaaaccccagctacaagtatttttatgtcagtgccgagcaagttgttcaggggatgaaggaagctcaggaaaggctgacgggtgatgccttcagaaagaaacatcttgaagatgaattgtaa
Sequence Length
519
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,206 Da
NCBI Official Full Name
Homo sapiens thioredoxin domain containing 12 (endoplasmic reticulum), mRNA
NCBI Official Synonym Full Names
thioredoxin domain containing 12
NCBI Official Symbol
TXNDC12
NCBI Official Synonym Symbols
AG1; AGR1; ERP16; ERP18; ERP19; TLP19; hAG-1; PDIA16; hTLP19
NCBI Protein Information
thioredoxin domain-containing protein 12
UniProt Protein Name
Thioredoxin domain-containing protein 12
UniProt Gene Name
TXNDC12
UniProt Synonym Gene Names
TLP19; ER protein 18; ERp18; ER protein 19; ERp19
UniProt Entry Name
TXD12_HUMAN

NCBI Description

This gene encodes a member of the thioredoxin superfamily. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. This protein localizes to the endoplasmic reticulum and has a single atypical active motif. The encoded protein is mainly involved in catalyzing native disulfide bond formation and displays activity similar to protein-disulfide isomerases. This protein may play a role in defense against endoplasmic reticulum stress. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]

Uniprot Description

TXNDC12: Possesses significant protein thiol-disulfide oxidase activity.

Protein type: Oxidoreductase; Endoplasmic reticulum; EC 1.8.4.2; Secreted, signal peptide; Secreted; Other Amino Acids Metabolism - glutathione

Chromosomal Location of Human Ortholog: 1p32.3

Cellular Component: endoplasmic reticulum lumen

Molecular Function: peptide disulfide oxidoreductase activity; protein binding

Research Articles on TXNDC12

Similar Products

Product Notes

The TXNDC12 txndc12 (Catalog #AAA1273494) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacgc ggcctcgtct cggggccacc tgtttgctgg gcttcagttt cctgctcctc gtcatctctt ctgatggaca taatgggctt ggaaagggtt ttggagatca tattcattgg aggacactgg aagatgggaa gaaagaagca gctgccagtg gactgcccct gatggtgatt attcataaat cctggtgtgg agcttgcaaa gctctaaagc ccaaatttgc agaatctacg gaaatttcag aactctccca taattttgtt atggtaaatc ttgaggatga agaggaaccc aaacatgaag atttcagccc tgacgggggt tatattccac gaatcctttt tctggatccc agtggcaagg tgcatcctga aatcatcaat gagaatggaa accccagcta caagtatttt tatgtcagtg ccgagcaagt tgttcagggg atgaaggaag ctcaggaaag gctgacgggt gatgccttca gaaagaaaca tcttgaagat gaattgtaa. It is sometimes possible for the material contained within the vial of "TXNDC12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.