TXNDC11 cdna clone
TXNDC11 cDNA Clone
Gene Names
TXNDC11; EFP1
Synonyms
TXNDC11; TXNDC11 cDNA Clone; TXNDC11 cdna clone
Sequence
atgaagctcaccctagagtcttttattcaaaacttcagcgttctctatagtcccttgaaaaggcatctcattggaagtggctctgcccagttcccgtctcagcatttaatcactgaagtgacaactgataccttttgggaagtagtccttcaaaaacaggacgttctcctgctctattacgctccgtggtgcggcttctgtccatccctcaatcacatcttcatccagctagctcggaacctgcccatggacacattcactgtggcaaggattgacgtgtctcagaatgaccttccttgggaatttatggtcgatcgtcttcctactgtcttgttttttccctgcaacagaaaggacctaagtgtgaaataccccgaagacgtccccatcacccttccaaacctgttgaggttcattttgcatcactcagaccctgcttccagcccccagaatgtggctaactctcctaccaaggagtgtcttcagagcgaggcagtcttacagcgggggcacatctcccacttggagagagagatccagaaactgagagcagaaataagcagcctccagcgagcacaagtgcaggtggagtcccagctctccagtgcccgcagagatgagcaccggctgcggcagcagcagcgggccctggaagagcagcacagcctgctccacgcacacagtgagcagctgcaggccctctatgagcagaagacacgtgagctgcaggagctggcccgcaagctgcaggagctggccgatgcctcagaaaacctccttaccgagaacacgtggctcaagatcctggtggcgaccatggagaggaaactggagggcagggatggagctgaaagcctggcggcccagagagaggtccaccccaagcagcctgagccctcagccaccccccagctccctggcagctcccctccacctgccaatgtcagcgccacactggtgtctgaaaggaataaggagaacaggacagactaa
Sequence Length
993
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,375 Da
NCBI Official Full Name
Homo sapiens thioredoxin domain containing 11, mRNA
NCBI Official Synonym Full Names
thioredoxin domain containing 11
NCBI Official Symbol
TXNDC11
NCBI Official Synonym Symbols
EFP1
NCBI Protein Information
thioredoxin domain-containing protein 11
UniProt Protein Name
Thioredoxin domain-containing protein 11
Protein Family
UniProt Gene Name
TXNDC11
UniProt Synonym Gene Names
EFP1
UniProt Entry Name
TXD11_HUMAN
Uniprot Description
TXNDC11: May act as a redox regulator involved in DUOX proteins folding. The interaction with DUOX1 and DUOX2 suggest that it belongs to a multiprotein complex constituting the thyroid H(2)O(2) generating system. It is however not sufficient to assist DUOX1 and DUOX2 in H(2)O(2) generation. Belongs to the protein disulfide isomerase family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 16p13.13
Cellular Component: endoplasmic reticulum
Molecular Function: protein binding; protein disulfide isomerase activity
Biological Process: protein folding
Research Articles on TXNDC11
Similar Products
Product Notes
The TXNDC11 txndc11 (Catalog #AAA1273541) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctca ccctagagtc ttttattcaa aacttcagcg ttctctatag tcccttgaaa aggcatctca ttggaagtgg ctctgcccag ttcccgtctc agcatttaat cactgaagtg acaactgata ccttttggga agtagtcctt caaaaacagg acgttctcct gctctattac gctccgtggt gcggcttctg tccatccctc aatcacatct tcatccagct agctcggaac ctgcccatgg acacattcac tgtggcaagg attgacgtgt ctcagaatga ccttccttgg gaatttatgg tcgatcgtct tcctactgtc ttgttttttc cctgcaacag aaaggaccta agtgtgaaat accccgaaga cgtccccatc acccttccaa acctgttgag gttcattttg catcactcag accctgcttc cagcccccag aatgtggcta actctcctac caaggagtgt cttcagagcg aggcagtctt acagcggggg cacatctccc acttggagag agagatccag aaactgagag cagaaataag cagcctccag cgagcacaag tgcaggtgga gtcccagctc tccagtgccc gcagagatga gcaccggctg cggcagcagc agcgggccct ggaagagcag cacagcctgc tccacgcaca cagtgagcag ctgcaggccc tctatgagca gaagacacgt gagctgcagg agctggcccg caagctgcag gagctggccg atgcctcaga aaacctcctt accgagaaca cgtggctcaa gatcctggtg gcgaccatgg agaggaaact ggagggcagg gatggagctg aaagcctggc ggcccagaga gaggtccacc ccaagcagcc tgagccctca gccacccccc agctccctgg cagctcccct ccacctgcca atgtcagcgc cacactggtg tctgaaagga ataaggagaa caggacagac taa. It is sometimes possible for the material contained within the vial of "TXNDC11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
