Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSPAN17 cdna clone

TSPAN17 cDNA Clone

Gene Names
TSPAN17; FBX23; FBXO23; TM4SF17
Synonyms
TSPAN17; TSPAN17 cDNA Clone; TSPAN17 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccggcaagcaccagcatttccaggaacctgaggtcggctgctgcgggaaatacttcctgtttggcttcaacattgtcttctgggtgctgggagccctgttcctggctatcggcctctgggcctggggtgagaagggcgttctctcgaacatctcagcgctgacagatctgggaggccttgaccccgtgtggctgtttgtggtagttggaggcgtcatgtcggtgctgggctttgctggctgcattggggccctccgggagaacaccttcctgctcaagtttttctccgtgttcctcggtctcatcttcttcctggagctggcaacagggatcctggcctttgtcttcaaggactggattcgagaccagctcaacctcttcatcaacaacaacgtcaaggcctaccgggacgacattgacctccagaacctcattgactttgctcaggaatactggtcttgctgcggagcccgaggccccaatgactggaacctcaatatctacttcaactgcactgacttgaaccccagccgggagcgctgcggggtgcccttctcctgctgcgtcagggaccctgcggaggatgtcctcaacacccagtgtggctacgacgtccggctcaaactggagctggagcagcagggcttcatccacaccaaaggctgcgtgggccagtttgagaagtggctgcaggacaacctgattgtggtggcgggagtcttcatgggcatcgccctcctccagatctttggcatctgcctggcccagaacctcgagcaaatggaatga
Sequence Length
792
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,742 Da
NCBI Official Full Name
Homo sapiens tetraspanin 17, mRNA
NCBI Official Synonym Full Names
tetraspanin 17
NCBI Official Symbol
TSPAN17
NCBI Official Synonym Symbols
FBX23; FBXO23; TM4SF17
NCBI Protein Information
tetraspanin-17
UniProt Protein Name
Tetraspanin-17
UniProt Gene Name
TSPAN17
UniProt Synonym Gene Names
FBXO23; TM4SF17; Tspan-17
UniProt Entry Name
TSN17_HUMAN

NCBI Description

This gene encodes a member of the transmembrane 4 superfamily. It is characterized by four tetraspanin transmembrane segments. The function of this gene has not yet been determined. [provided by RefSeq, Mar 2014]

Uniprot Description

TSPAN17: a multi-pass membrane protein. Member of the transmembrane 4 superfamily, also known as the tetraspanin family. These proteins apparently mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: integral to plasma membrane

Molecular Function: enzyme binding

Biological Process: cell surface receptor linked signal transduction; positive regulation of Notch signaling pathway

Similar Products

Product Notes

The TSPAN17 tspan17 (Catalog #AAA1276258) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccggca agcaccagca tttccaggaa cctgaggtcg gctgctgcgg gaaatacttc ctgtttggct tcaacattgt cttctgggtg ctgggagccc tgttcctggc tatcggcctc tgggcctggg gtgagaaggg cgttctctcg aacatctcag cgctgacaga tctgggaggc cttgaccccg tgtggctgtt tgtggtagtt ggaggcgtca tgtcggtgct gggctttgct ggctgcattg gggccctccg ggagaacacc ttcctgctca agtttttctc cgtgttcctc ggtctcatct tcttcctgga gctggcaaca gggatcctgg cctttgtctt caaggactgg attcgagacc agctcaacct cttcatcaac aacaacgtca aggcctaccg ggacgacatt gacctccaga acctcattga ctttgctcag gaatactggt cttgctgcgg agcccgaggc cccaatgact ggaacctcaa tatctacttc aactgcactg acttgaaccc cagccgggag cgctgcgggg tgcccttctc ctgctgcgtc agggaccctg cggaggatgt cctcaacacc cagtgtggct acgacgtccg gctcaaactg gagctggagc agcagggctt catccacacc aaaggctgcg tgggccagtt tgagaagtgg ctgcaggaca acctgattgt ggtggcggga gtcttcatgg gcatcgccct cctccagatc tttggcatct gcctggccca gaacctcgag caaatggaat ga. It is sometimes possible for the material contained within the vial of "TSPAN17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.