TRPC4AP cdna clone
TRPC4AP cDNA Clone
Gene Names
TRPC4AP; TRUSS; TRRP4AP; PPP1R158; C20orf188
Synonyms
TRPC4AP; TRPC4AP cDNA Clone; TRPC4AP cdna clone
Sequence
atggcggcggcgccggtagcggctgggtctggagccggccgagggagacggtcggcagccacagtggcggcttggggcggatggggcggccggccgcggcctggtaacattctgctgcagctgcggcagggccagctgaccggccggggcctggtccgggcggtgcagttcactgagacttttttgacggagagggacaaacaatccaagtggagtggaattcctcagctgctcctcaagctgcacaccaccagccacctccacagtgactttgttgagtgtcaaaacatcctcaaggaaatttctcctcttctctccatggaggctatggcatttgttactgaagagaggaaacttacccaagaaaccacttatccaaatacttatatttttgacttgtttggaggtgttgatcttcttgtagaaattcttatgaggcctacgatctctatccggggacagaaactgaaaataagtgatgaaatgtccaaggactgcttgagtatcctgtataatacctgtgtctgtacagagggagttacaaagcgtttggcagaaaagaatgactttgtgatcttcctgtttacattgatgacaagtaagaagacattcttacaaacagcaaccctcattgaagatattttgggtgttaaaaaggaaatgatccgactagatgaagtccccaatctgagttccttagtatccaatttcgatcagcagcagctcgctaatttctgccggattctggctgtcaccatttcagagatggatacagggaatgatgacaagcacacgcttcttgccaaaaatgctcaacagaagaagagcttgagtttggggccttctgcagctgaaatcaatcaagcggcccttctcagcattcctggctttgttgagcggctttgcaaactggcgactcgaaaggtgtcagagtcaacgggcacagccagcttccttcaggagttggaagagtggtacacatggctagacaatgctttggtgctagatgccctgatgcgagtggccaatgaggagtcagagcacaatcaagcctccattgtgttccctcctccaggggcttctgaggagaatggcctgcctcacacgtcagccagaacccagctgccccagtcaatgaagattatgcatgagatcatgtacaaactggaagtgctctatgtcctctgcgtgctgctgatggggcgtcagcgaaaccaggttcacagaatgattgcagagttcaagctgatccctggacttaataatttgtttgacaaactgatttggaggaagcattcagcatctgcccttgtcctccatggtcacaaccagaactgtgactgtagcccggacatcaccttgaagatacagtttttgaggcttcttcagagcttcagtgaccaccacgagaacaagtacttgttactcaacaaccaggagctgaatgaactcagtgccatctctctcaaggccaacatccctgaggtggaagctgtcctcaacaccgacaggagtttggtgtgtgatgggaagaggggcttattaactcgtctgctgcaggtcatgaagaaggagccagcagagtcgtctttcaggttttggcaagctcgggctgtggagagtttcctccgagggaccacctcctatgcagaccagatgttcctgctgaagcgaggcctcttggagcacatcctttactgcattgtggacagcgagtgtaagtcaagggatgtgctccagagttactttgacctcctgggggagctgatgaagttcaacgttgatgcattcaagagattcaataaatatatcaacaccgatgcaaagttccaggtattcctgaagcagatcaacagctccctggtggactccaacatgctggtgcgctgtgtcactctgtccctggaccgatttgaaaaccaggtggatatgaaagttgccgaggtactgtctgaatgccgcctgctcgcctacatatcccaggtgcccacgcagatgtccttcctcttccgcctcatcaacatcatccacgtgcagacgctgacccaggagaacgtcagctgcctcaacaccagcctggtgatcctgatgctggcccgacggaaagagcggctgcccctgtacctgcggctgctgcagcggatggagcacagcaagaagtaccccggcttcctgctcaacaacttccacaacctgctgcgcttctggcagcagcactacctgcacaaggacaaggacagcacctgcctagagaacagctcctgcatcagcttctcatactggaaggagacagtgtccatcctgttgaacccggaccggcagtcaccctctgctctcgttagctacattgaggagccctacatggacatagacagggacttcactgaggagtga
Sequence Length
2394
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
90,043 Da
NCBI Official Full Name
Homo sapiens transient receptor potential cation channel, subfamily C, member 4 associated protein, mRNA
NCBI Official Synonym Full Names
transient receptor potential cation channel subfamily C member 4 associated protein
NCBI Official Symbol
TRPC4AP
NCBI Official Synonym Symbols
TRUSS; TRRP4AP; PPP1R158; C20orf188
NCBI Protein Information
short transient receptor potential channel 4-associated protein
UniProt Protein Name
Short transient receptor potential channel 4-associated protein
UniProt Gene Name
TRPC4AP
UniProt Synonym Gene Names
C20orf188; TRRP4AP; Trp4-associated protein; Trpc4-associated protein; Protein TRUSS
UniProt Entry Name
TP4AP_HUMAN
Uniprot Description
TRPC4AP: Substrate-specific adapter of a DCX (DDB1-CUL4-X-box) E3 ubiquitin-protein ligase complex required for cell cycle control. The DCX(TRUSS) complex specifically mediates the polyubiquitination and subsequent degradation of MYC. Also participates in the activation of NFKB1 in response to ligation of TNFRSF1A, possibly by linking TNFRSF1A to the IKK signalosome. Involved in JNK activation via its interaction with TRAF2. Also involved in elevation of endoplasmic reticulum Ca(2+) storage reduction in response to CHRM1. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 20q11.22
Cellular Component: plasma membrane
Molecular Function: calcium channel activity; phosphatase binding; protein binding
Biological Process: protein ubiquitination; ubiquitin-dependent protein catabolic process
Research Articles on TRPC4AP
Similar Products
Product Notes
The TRPC4AP trpc4ap (Catalog #AAA1272603) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cgccggtagc ggctgggtct ggagccggcc gagggagacg gtcggcagcc acagtggcgg cttggggcgg atggggcggc cggccgcggc ctggtaacat tctgctgcag ctgcggcagg gccagctgac cggccggggc ctggtccggg cggtgcagtt cactgagact tttttgacgg agagggacaa acaatccaag tggagtggaa ttcctcagct gctcctcaag ctgcacacca ccagccacct ccacagtgac tttgttgagt gtcaaaacat cctcaaggaa atttctcctc ttctctccat ggaggctatg gcatttgtta ctgaagagag gaaacttacc caagaaacca cttatccaaa tacttatatt tttgacttgt ttggaggtgt tgatcttctt gtagaaattc ttatgaggcc tacgatctct atccggggac agaaactgaa aataagtgat gaaatgtcca aggactgctt gagtatcctg tataatacct gtgtctgtac agagggagtt acaaagcgtt tggcagaaaa gaatgacttt gtgatcttcc tgtttacatt gatgacaagt aagaagacat tcttacaaac agcaaccctc attgaagata ttttgggtgt taaaaaggaa atgatccgac tagatgaagt ccccaatctg agttccttag tatccaattt cgatcagcag cagctcgcta atttctgccg gattctggct gtcaccattt cagagatgga tacagggaat gatgacaagc acacgcttct tgccaaaaat gctcaacaga agaagagctt gagtttgggg ccttctgcag ctgaaatcaa tcaagcggcc cttctcagca ttcctggctt tgttgagcgg ctttgcaaac tggcgactcg aaaggtgtca gagtcaacgg gcacagccag cttccttcag gagttggaag agtggtacac atggctagac aatgctttgg tgctagatgc cctgatgcga gtggccaatg aggagtcaga gcacaatcaa gcctccattg tgttccctcc tccaggggct tctgaggaga atggcctgcc tcacacgtca gccagaaccc agctgcccca gtcaatgaag attatgcatg agatcatgta caaactggaa gtgctctatg tcctctgcgt gctgctgatg gggcgtcagc gaaaccaggt tcacagaatg attgcagagt tcaagctgat ccctggactt aataatttgt ttgacaaact gatttggagg aagcattcag catctgccct tgtcctccat ggtcacaacc agaactgtga ctgtagcccg gacatcacct tgaagataca gtttttgagg cttcttcaga gcttcagtga ccaccacgag aacaagtact tgttactcaa caaccaggag ctgaatgaac tcagtgccat ctctctcaag gccaacatcc ctgaggtgga agctgtcctc aacaccgaca ggagtttggt gtgtgatggg aagaggggct tattaactcg tctgctgcag gtcatgaaga aggagccagc agagtcgtct ttcaggtttt ggcaagctcg ggctgtggag agtttcctcc gagggaccac ctcctatgca gaccagatgt tcctgctgaa gcgaggcctc ttggagcaca tcctttactg cattgtggac agcgagtgta agtcaaggga tgtgctccag agttactttg acctcctggg ggagctgatg aagttcaacg ttgatgcatt caagagattc aataaatata tcaacaccga tgcaaagttc caggtattcc tgaagcagat caacagctcc ctggtggact ccaacatgct ggtgcgctgt gtcactctgt ccctggaccg atttgaaaac caggtggata tgaaagttgc cgaggtactg tctgaatgcc gcctgctcgc ctacatatcc caggtgccca cgcagatgtc cttcctcttc cgcctcatca acatcatcca cgtgcagacg ctgacccagg agaacgtcag ctgcctcaac accagcctgg tgatcctgat gctggcccga cggaaagagc ggctgcccct gtacctgcgg ctgctgcagc ggatggagca cagcaagaag taccccggct tcctgctcaa caacttccac aacctgctgc gcttctggca gcagcactac ctgcacaagg acaaggacag cacctgccta gagaacagct cctgcatcag cttctcatac tggaaggaga cagtgtccat cctgttgaac ccggaccggc agtcaccctc tgctctcgtt agctacattg aggagcccta catggacata gacagggact tcactgagga gtga. It is sometimes possible for the material contained within the vial of "TRPC4AP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
