TRMT2B cdna clone
TRMT2B cDNA Clone
Gene Names
TRMT2B; CXorf34; dJ341D10.3
Synonyms
TRMT2B; TRMT2B cDNA Clone; TRMT2B cdna clone
Sequence
atggcaggccttaagagaagagtcccactgcacagcctcagatacttcatctccatggtgggtctcttctccaaaccaggactgcttccctggtatgccagaaatccaccaggatggtcacagctctttctgggcacagtatgtaagggagatttcacccgtgtgatagccacgaaatgtcagaaaggacaaaaaagtcagaagaaaccaagccatcttggaccactagatggttcctggcaggaaaggctggctgatgttgtgacaccactctggaggttgagctatgaagaacagctcaaggtgaaatttgcagctcagaagaaaattttacaaagactagagtcttacatccaaatgctcaatggagtcagtgtgacaacggctgtacccaaatctgagaggctctcttgtcttctccatcctattataccctctcctgtcatcaatggttaccgaaataagtccaccttctctgtgaaccgaggtccagatggcaatccaaagactgtggggttctacctgggaacttggagagatgggaacgttgtctgtgtgcagtctaatcatctgaaaaacatccctgagaaacacagtcaagtggcgcagtactatgaagtattccttcgacagtctccattggagccctgccttgtatttcatgaaggtggatactggcgtgagctcacagtccgcaccaatagccaagggcacacaatggctatcatcactttccatccccagaaattaagtcaggaggagctccatgttcagaaggagattgtaaaggaatttttcatcagaggtcctggagcagcctgtggcttgacctcactttacttccaggaaagtaccatgacccgttgcagccatcagcagtctccctatcagcttctgtttggggaaccctacatctttgaagaacttctgagcttgaagatccgcatctctccagatgcctttttccagattaacacagctggtgcagagatgctgtatcggactgtgggggagctgactggagtgaactctgacaccatccttcttgacatctgctgtggaactggtgtgattggcctctctctggctcagcatacatctcgggtccttgggattgaattgttggagcaggcagtggaggatgcaagatggactgcagccttcaatggcatcaccaactctgaatttcatactggtcaagcagagaagattttgccagggctgctaaagtcaaaggaagatggacagtcaattgttgctgtggtgaacccagcccgtgccggactgcattacaaggtgattcaagccattcgaaacttcagggccatccacacgctagtttttgtttcctgcaagctccatggtgaatccactaggaatgtcattgaacggagtctcatcttgctggagtgcagtggcatggtctcggctcactgcagcctccacctcccaggttcaagcgattctcctgcctcagcctcctga
Sequence Length
1485
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,485 Da
NCBI Official Full Name
Homo sapiens TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
tRNA methyltransferase 2 homolog B
NCBI Official Symbol
TRMT2B
NCBI Official Synonym Symbols
CXorf34; dJ341D10.3
NCBI Protein Information
tRNA (uracil(54)-C(5))-methyltransferase homolog
UniProt Protein Name
tRNA (uracil(54)-C(5))-methyltransferase homolog
Protein Family
UniProt Gene Name
TRMT2B
UniProt Synonym Gene Names
CXorf34
UniProt Entry Name
TRM2_HUMAN
NCBI Description
This gene encodes a homolog of the TRM2 gene in S. cerevisiae. The yeast gene encodes a tRNA methyltransferase that plays a role in tRNA maturation. The yeast protein also has endo-exonuclease activity and may be involved in DNA double strand break repair. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Nov 2009]
Uniprot Description
TRMT2B: Probable S-adenosyl-L-methionine-dependent methyltransferase that catalyzes the formation of 5-methyl-uridine at position 54 (m5U54) in all tRNA. May also have a role in tRNA stabilization or maturation. Belongs to the methyltransferase superfamily. RNA M5U methyltransferase family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Methyltransferase; EC 2.1.1.35
Chromosomal Location of Human Ortholog: Xq22.1
Molecular Function: protein binding
Similar Products
Product Notes
The TRMT2B trmt2b (Catalog #AAA1278453) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggcc ttaagagaag agtcccactg cacagcctca gatacttcat ctccatggtg ggtctcttct ccaaaccagg actgcttccc tggtatgcca gaaatccacc aggatggtca cagctctttc tgggcacagt atgtaaggga gatttcaccc gtgtgatagc cacgaaatgt cagaaaggac aaaaaagtca gaagaaacca agccatcttg gaccactaga tggttcctgg caggaaaggc tggctgatgt tgtgacacca ctctggaggt tgagctatga agaacagctc aaggtgaaat ttgcagctca gaagaaaatt ttacaaagac tagagtctta catccaaatg ctcaatggag tcagtgtgac aacggctgta cccaaatctg agaggctctc ttgtcttctc catcctatta taccctctcc tgtcatcaat ggttaccgaa ataagtccac cttctctgtg aaccgaggtc cagatggcaa tccaaagact gtggggttct acctgggaac ttggagagat gggaacgttg tctgtgtgca gtctaatcat ctgaaaaaca tccctgagaa acacagtcaa gtggcgcagt actatgaagt attccttcga cagtctccat tggagccctg ccttgtattt catgaaggtg gatactggcg tgagctcaca gtccgcacca atagccaagg gcacacaatg gctatcatca ctttccatcc ccagaaatta agtcaggagg agctccatgt tcagaaggag attgtaaagg aatttttcat cagaggtcct ggagcagcct gtggcttgac ctcactttac ttccaggaaa gtaccatgac ccgttgcagc catcagcagt ctccctatca gcttctgttt ggggaaccct acatctttga agaacttctg agcttgaaga tccgcatctc tccagatgcc tttttccaga ttaacacagc tggtgcagag atgctgtatc ggactgtggg ggagctgact ggagtgaact ctgacaccat ccttcttgac atctgctgtg gaactggtgt gattggcctc tctctggctc agcatacatc tcgggtcctt gggattgaat tgttggagca ggcagtggag gatgcaagat ggactgcagc cttcaatggc atcaccaact ctgaatttca tactggtcaa gcagagaaga ttttgccagg gctgctaaag tcaaaggaag atggacagtc aattgttgct gtggtgaacc cagcccgtgc cggactgcat tacaaggtga ttcaagccat tcgaaacttc agggccatcc acacgctagt ttttgtttcc tgcaagctcc atggtgaatc cactaggaat gtcattgaac ggagtctcat cttgctggag tgcagtggca tggtctcggc tcactgcagc ctccacctcc caggttcaag cgattctcct gcctcagcct cctga. It is sometimes possible for the material contained within the vial of "TRMT2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
