Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIP11 cdna clone

TRIP11 cDNA Clone

Gene Names
TRIP11; ACG1A; CEV14; GMAP210; TRIP-11; TRIP230; GMAP-210
Synonyms
TRIP11; TRIP11 cDNA Clone; TRIP11 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtcctggcttgggggcctcggctccggattgggccagtctctgggtcaagtcgggggcagcctggcttccctcactggccagatatcaaactttacaaaggatatgctgatggagggcacggaggaagtggaagcagaattacctgattctaggacaaaggaaattgaagccattcatgcaatcttgagatcagagttgcctttgtgtacacacctgctttcagccttctacatatga
Sequence Length
243
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
227,586 Da
NCBI Official Full Name
Homo sapiens thyroid hormone receptor interactor 11, mRNA
NCBI Official Synonym Full Names
thyroid hormone receptor interactor 11
NCBI Official Symbol
TRIP11
NCBI Official Synonym Symbols
ACG1A; CEV14; GMAP210; TRIP-11; TRIP230; GMAP-210
NCBI Protein Information
thyroid receptor-interacting protein 11
UniProt Protein Name
Thyroid receptor-interacting protein 11
UniProt Gene Name
TRIP11
UniProt Synonym Gene Names
CEV14; TR-interacting protein 11; TRIP-11; GMAP-210
UniProt Entry Name
TRIPB_HUMAN

NCBI Description

This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]

Uniprot Description

TRIP11: Binds the ligand binding domain of the thyroid receptor (THRB) in the presence of triiodothyronine and enhances THRB- modulated transcription. Golgi auto-antigen; probably involved in maintaining cis-Golgi structure. A chromosomal aberration involving TRIP11 may be a cause of acute myelogenous leukemia. Translocation t(5;14)(q33;q32) with PDGFRB. The fusion protein may be involved in clonal evolution of leukemia and eosinophilia. Defects in TRIP11 are the cause of achondrogenesis type 1A (ACG1A). A form of achondrogenesis type 1, a lethal form of chondrodysplasia characterized by deficient ossification in the lumbar vertebrae and absent ossification in the sacral, pubic and ischial bones and clinically by stillbirth or early death. In addition to severe micromelia, there is a disproportionately large cranium due to marked edema of soft tissues.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 14q31-q32

Cellular Component: Golgi apparatus; Golgi membrane; nucleus; transport vesicle

Molecular Function: protein binding; transcription coactivator activity

Biological Process: transcription from RNA polymerase II promoter

Disease: Achondrogenesis, Type Ia

Research Articles on TRIP11

Similar Products

Product Notes

The TRIP11 trip11 (Catalog #AAA1267776) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtcct ggcttggggg cctcggctcc ggattgggcc agtctctggg tcaagtcggg ggcagcctgg cttccctcac tggccagata tcaaacttta caaaggatat gctgatggag ggcacggagg aagtggaagc agaattacct gattctagga caaaggaaat tgaagccatt catgcaatct tgagatcaga gttgcctttg tgtacacacc tgctttcagc cttctacata tga. It is sometimes possible for the material contained within the vial of "TRIP11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.