Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM31 cdna clone

TRIM31 cDNA Clone

Gene Names
TRIM31; RNF; HCG1; HCGI; C6orf13
Synonyms
TRIM31; TRIM31 cDNA Clone; TRIM31 cdna clone
Ordering
For Research Use Only!
Sequence
atgaataaaaatgacatgaagagctggggcttgttacagaaaaataatcataaaatgaacaaaacctcagagcccgggtcatcttctgcaggcggcagaactacatcggggccaccaaatcaccactcttcagccccatcccactccctgtttcgggcctcgtctgctgggaaagtcacttttccagtatgtctcctggcctcttatgatgagatttctggtcaaggagcgagctctcaggatacgaagacatttgacgttgcgctgtccgaggagctccatgcggcactgagtgagtggctgacagcgatccgggcttggttttgtgaggttccttcaagctaa
Sequence Length
345
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,831 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 31, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 31
NCBI Official Symbol
TRIM31
NCBI Official Synonym Symbols
RNF; HCG1; HCGI; C6orf13
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM31
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM31
UniProt Gene Name
TRIM31
UniProt Synonym Gene Names
C6orf13; RNF
UniProt Entry Name
TRI31_HUMAN

NCBI Description

This gene encodes a protein that functions as an E3 ubiquitin-protein ligase. This gene shows altered expression in certain tumors and may be a negative regulator of cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Uniprot Description

TRIM31: Regulator of Src-induced anchorage independent cell growth. May have E3 ubiquitin-protein ligase activity. Belongs to the TRIM/RBCC family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cytosol

Molecular Function: protein binding

Biological Process: innate immune response; negative regulation of viral transcription; negative regulation of virion penetration into host cell; positive regulation of transcription factor activity

Research Articles on TRIM31

Similar Products

Product Notes

The TRIM31 trim31 (Catalog #AAA1266518) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaataaaa atgacatgaa gagctggggc ttgttacaga aaaataatca taaaatgaac aaaacctcag agcccgggtc atcttctgca ggcggcagaa ctacatcggg gccaccaaat caccactctt cagccccatc ccactccctg tttcgggcct cgtctgctgg gaaagtcact tttccagtat gtctcctggc ctcttatgat gagatttctg gtcaaggagc gagctctcag gatacgaaga catttgacgt tgcgctgtcc gaggagctcc atgcggcact gagtgagtgg ctgacagcga tccgggcttg gttttgtgag gttccttcaa gctaa. It is sometimes possible for the material contained within the vial of "TRIM31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.