Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRAF5 cdna clone

TRAF5 cDNA Clone

Gene Names
TRAF5; RNF84; MGC:39780
Synonyms
TRAF5; TRAF5 cDNA Clone; TRAF5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttattcagaagagcataaaggtatgccctgtggtttcatccgccagaattccggcaactccatttccttggactttgagcccagtatagagtaccagtttgtggagcggttggaagagcgctacaaatgtgccttctgccactcggtgcttcacaacccccaccagacaggatgtgggcaccgcttctgccagcactgcatcctgtccctgagagaattaaacacagtgccaatctgccctgtagataaagaggtcatcaaatctcaggaggtttttaaagacaattgttgcaaaagagaagtcctcaacttatatgtatattgcagcaatgctcctggatgtaatgccaaggttattctgggccggtaccaggatcaccttcagcagtgcttatttcaacctgtgcagtgttctaatgagaagtgccgggagccagtcctacggaaagacctgaaagagcatttgagtgcatcctgtcagtttcgaaaggaaaaatgcctttattgcaaaaaggatgtggtagtcatcaatctacagaatcatgaggaaaacttgtgtcctgaatacccagtattttgtcccaacaattgtgcgaagattattctaaaaactgaggtagatgaacacctggctgtatgtcctgaagctgagcaagactgtccttttaagcactatggctgtgctgtaacggataaacggaggaacctgcagcaacatgagcattcagccttacgggagcacatgcgtttggttttagaaaagaatgtccaattagaagaacagatttctgacttacacaagagcctagaacagaaagaaagtaaaatccagcagctagcagaaactataaagaaacttgaaaaggagttcaagcagtttgcacagttgtttggcaaaaatggaagcttcctcccaaacatccaggtttttgccagtcacattgacaagtcagcttggctagaagctcaagtgcatcaattattacaaatggttaaccagcaacaaaataaatttgacctgagacctttgatggaagcagttgatacagtgaaacagaaaattaccctgctagaaaacaatgatcaaagattagccgttttagaagaggaaactaacaaacatgatacccacattaatattcataaagcacagctgagtaaaaatgaagagcgatttaaactgctggagggtacttgctataatggaaagctcatttggaaggtgacagattacaagatgaagaagagagaggcggtggatgggcacacagtgtccatcttcagccagtccttctacaccagccgctgtggctaccggctctgtgctagagcatacctgaatggggatgggtcagggagggggtcacacctgtccctatactttgtggtcatgcgaggagagtttgactcactgttgcagtggccattcaggcagagggtgaccctgatgcttctggaccagagtggcaaaaagaacattatggagaccttcaaacctgaccccaatagcagcagctttaaaagacctgatggggagatgaacattgcatctggctgtccccgctttgtggctcattctgttttggagaatgccaagaacgcctacattaaagatgacactctgttcttgaaagtggccgtggacttaactgacctggaggatctctag
Sequence Length
1674
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,158 Da
NCBI Official Full Name
Homo sapiens TNF receptor-associated factor 5, mRNA
NCBI Official Synonym Full Names
TNF receptor associated factor 5
NCBI Official Symbol
TRAF5
NCBI Official Synonym Symbols
RNF84; MGC:39780
NCBI Protein Information
TNF receptor-associated factor 5
UniProt Protein Name
TNF receptor-associated factor 5
UniProt Gene Name
TRAF5
UniProt Synonym Gene Names
RNF84
UniProt Entry Name
TRAF5_HUMAN

NCBI Description

The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]

Uniprot Description

TRAF5: Adapter protein and signal transducer that links members of the tumor necrosis factor receptor family to different signaling pathways by association with the receptor cytoplasmic domain and kinases. Mediates activation of NF-kappa-B and probably JNK. Seems to be involved in apoptosis. Belongs to the TNF receptor-associated factor family. A subfamily.

Protein type: Ubiquitin conjugating system; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: centrosome; cytoplasm; cytosol; internal side of plasma membrane

Molecular Function: protein binding; thioesterase binding; ubiquitin protein ligase binding

Biological Process: activation of NF-kappaB transcription factor; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of transcription factor activity

Research Articles on TRAF5

Similar Products

Product Notes

The TRAF5 traf5 (Catalog #AAA1278731) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttatt cagaagagca taaaggtatg ccctgtggtt tcatccgcca gaattccggc aactccattt ccttggactt tgagcccagt atagagtacc agtttgtgga gcggttggaa gagcgctaca aatgtgcctt ctgccactcg gtgcttcaca acccccacca gacaggatgt gggcaccgct tctgccagca ctgcatcctg tccctgagag aattaaacac agtgccaatc tgccctgtag ataaagaggt catcaaatct caggaggttt ttaaagacaa ttgttgcaaa agagaagtcc tcaacttata tgtatattgc agcaatgctc ctggatgtaa tgccaaggtt attctgggcc ggtaccagga tcaccttcag cagtgcttat ttcaacctgt gcagtgttct aatgagaagt gccgggagcc agtcctacgg aaagacctga aagagcattt gagtgcatcc tgtcagtttc gaaaggaaaa atgcctttat tgcaaaaagg atgtggtagt catcaatcta cagaatcatg aggaaaactt gtgtcctgaa tacccagtat tttgtcccaa caattgtgcg aagattattc taaaaactga ggtagatgaa cacctggctg tatgtcctga agctgagcaa gactgtcctt ttaagcacta tggctgtgct gtaacggata aacggaggaa cctgcagcaa catgagcatt cagccttacg ggagcacatg cgtttggttt tagaaaagaa tgtccaatta gaagaacaga tttctgactt acacaagagc ctagaacaga aagaaagtaa aatccagcag ctagcagaaa ctataaagaa acttgaaaag gagttcaagc agtttgcaca gttgtttggc aaaaatggaa gcttcctccc aaacatccag gtttttgcca gtcacattga caagtcagct tggctagaag ctcaagtgca tcaattatta caaatggtta accagcaaca aaataaattt gacctgagac ctttgatgga agcagttgat acagtgaaac agaaaattac cctgctagaa aacaatgatc aaagattagc cgttttagaa gaggaaacta acaaacatga tacccacatt aatattcata aagcacagct gagtaaaaat gaagagcgat ttaaactgct ggagggtact tgctataatg gaaagctcat ttggaaggtg acagattaca agatgaagaa gagagaggcg gtggatgggc acacagtgtc catcttcagc cagtccttct acaccagccg ctgtggctac cggctctgtg ctagagcata cctgaatggg gatgggtcag ggagggggtc acacctgtcc ctatactttg tggtcatgcg aggagagttt gactcactgt tgcagtggcc attcaggcag agggtgaccc tgatgcttct ggaccagagt ggcaaaaaga acattatgga gaccttcaaa cctgacccca atagcagcag ctttaaaaga cctgatgggg agatgaacat tgcatctggc tgtccccgct ttgtggctca ttctgttttg gagaatgcca agaacgccta cattaaagat gacactctgt tcttgaaagt ggccgtggac ttaactgacc tggaggatct ctag. It is sometimes possible for the material contained within the vial of "TRAF5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.