Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TNFAIP6 cdna clone

TNFAIP6 cDNA Clone

Gene Names
TNFAIP6; TSG6; TSG-6
Synonyms
TNFAIP6; TNFAIP6 cDNA Clone; TNFAIP6 cdna clone
Ordering
For Research Use Only!
Sequence
atgatcatcttaatttacttatttctcttgctatgggaagacactcaaggatggggattcaaggatggaatttttcataactccatatggcttgaacgagcagccggtgtgtaccacagagaagcacggtctggcaaatacaagctcacctacgcagaagctaaggcggtgtgtgaatttgaaggcggccatctcgcaacttacaagcagctagaggcagccagaaaaattggatttcatgtctgtgctgctggatggatggctaagggcagagttggataccccattgtgaagccagggcccaactgtggatttggaaaaactggcattattgattatggaatccgtctcaataggagtgaaagatgggatgcctattgctacaacccacacgcaaaggagtgtggtggcgtctttacagatccaaagcaaatttttaaatctccaggcttcccaaatgagtacgaagataaccaaatctgctactggcacattagactcaagtatggtcagcgtattcacctgagttttttagattttgaccttgaagatgacccaggttgcttggctgattatgttgaaatatatgacagttacgatgatgtccatggctttgtgggaagatactgtggagatgagcttccagatgacatcatcagtacaggaaatgtcatgaccttgaagtttctaagtgatgcttcagtgacagctggaggtttccaaatcaaatatgttgcaatggatcctgtatccaaatccagtcaaggaaaaaatacaagtactacttctactggaaataaaaactttttagctggaagatttagccacttataa
Sequence Length
834
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,203 Da
NCBI Official Full Name
Homo sapiens tumor necrosis factor, alpha-induced protein 6, mRNA
NCBI Official Synonym Full Names
TNF alpha induced protein 6
NCBI Official Symbol
TNFAIP6
NCBI Official Synonym Symbols
TSG6; TSG-6
NCBI Protein Information
tumor necrosis factor-inducible gene 6 protein
UniProt Protein Name
Tumor necrosis factor-inducible gene 6 protein
UniProt Gene Name
TNFAIP6
UniProt Synonym Gene Names
TSG6; TSG-6; TNF alpha-induced protein 6
UniProt Entry Name
TSG6_HUMAN

NCBI Description

The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]

Uniprot Description

TNFAIP6: Possibly involved in cell-cell and cell-matrix interactions during inflammation and tumorigenesis.

Chromosomal Location of Human Ortholog: 2q23.3

Molecular Function: protein binding

Biological Process: cell-cell signaling; inflammatory response; negative regulation of inflammatory response; signal transduction

Research Articles on TNFAIP6

Similar Products

Product Notes

The TNFAIP6 tnfaip6 (Catalog #AAA1276601) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcatct taatttactt atttctcttg ctatgggaag acactcaagg atggggattc aaggatggaa tttttcataa ctccatatgg cttgaacgag cagccggtgt gtaccacaga gaagcacggt ctggcaaata caagctcacc tacgcagaag ctaaggcggt gtgtgaattt gaaggcggcc atctcgcaac ttacaagcag ctagaggcag ccagaaaaat tggatttcat gtctgtgctg ctggatggat ggctaagggc agagttggat accccattgt gaagccaggg cccaactgtg gatttggaaa aactggcatt attgattatg gaatccgtct caataggagt gaaagatggg atgcctattg ctacaaccca cacgcaaagg agtgtggtgg cgtctttaca gatccaaagc aaatttttaa atctccaggc ttcccaaatg agtacgaaga taaccaaatc tgctactggc acattagact caagtatggt cagcgtattc acctgagttt tttagatttt gaccttgaag atgacccagg ttgcttggct gattatgttg aaatatatga cagttacgat gatgtccatg gctttgtggg aagatactgt ggagatgagc ttccagatga catcatcagt acaggaaatg tcatgacctt gaagtttcta agtgatgctt cagtgacagc tggaggtttc caaatcaaat atgttgcaat ggatcctgta tccaaatcca gtcaaggaaa aaatacaagt actacttcta ctggaaataa aaacttttta gctggaagat ttagccactt ataa. It is sometimes possible for the material contained within the vial of "TNFAIP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.