Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TNFAIP3 cdna clone

TNFAIP3 cDNA Clone

Gene Names
TNFAIP3; A20; AISBL; OTUD7C; TNFA1P2
Synonyms
TNFAIP3; TNFAIP3 cDNA Clone; TNFAIP3 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgaacaagtccttcctcaggctttgtatttgagcaatatgcggaaagctgtgaagatacgggagagaactccagaagacatttttaaacctactaatgggatcattcatcattttaaaaccatgcaccgatacacactggaaatgttcagaacttgccagttttgtcctcagtttcgggagatcatccacaaagccctcatcgacagaaacatccaggccaccctggaaagccagaagaaactcaactggtgtcgagaagtccggaagcttgtggcgctgaaaacgaacggtgacggcaattgcctcatgcatgccacttctcagtacatgtggggcgttcaggacacagacttggtactgaggaaggcgctgttcagcacgctcaaggaaacagacacacgcaactttaaattccgctggcaactggagtctctcaaatctcaggaatttgttgaaacggggctttgctatgatactcggaactggaatgatgaatgggacaatcttatcaaaatggcttccacagacacacccatggcccgaagtggacttcagtacaactcactggaagaaatacacatatttgtcctttgcaacatcctcagaaggccaatcattgtcatttcaggtgagatgcctgcagatcacggatctgtacttaaatgctttcagccttatgccttggctcctggagaaaaccacactgccaaagttcaggtaacagagttcaatggaatttga
Sequence Length
747
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
89,614 Da
NCBI Official Full Name
Homo sapiens tumor necrosis factor, alpha-induced protein 3, mRNA
NCBI Official Synonym Full Names
TNF alpha induced protein 3
NCBI Official Symbol
TNFAIP3
NCBI Official Synonym Symbols
A20; AISBL; OTUD7C; TNFA1P2
NCBI Protein Information
tumor necrosis factor alpha-induced protein 3
UniProt Protein Name
Tumor necrosis factor alpha-induced protein 3
UniProt Gene Name
TNFAIP3
UniProt Synonym Gene Names
OTUD7C; TNF alpha-induced protein 3
UniProt Entry Name
TNAP3_HUMAN

NCBI Description

This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

TNFAIP3: Ubiquitin-editing enzyme that contains both ubiquitin ligase and deubiquitinase activities. Involved in immune and inflammatory responses signaled by cytokines, such as TNF-alpha and IL-1 beta, or pathogens via Toll-like receptors (TLRs) through terminating NF-kappa-B activity. Essential component of a ubiquitin-editing protein complex, comprising also RNF11, ITCH and TAX1BP1, that ensures the transient nature of inflammatory signaling pathways. In cooperation with TAX1BP1 promotes disassembly of E2-E3 ubiquitin protein ligase complexes in IL-1R and TNFR-1 pathways; affected are at least E3 ligases TRAF6, TRAF2 and BIRC2, and E2 ubiquitin-conjugating enzymes UBE2N and UBE2D3. In cooperation with TAX1BP1 promotes ubiquitination of UBE2N and proteasomal degradation of UBE2N and UBE2D3. Upon TNF stimulation, deubiquitinates 'Lys-63'-polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteasomal degradation and consequently termination of the TNF- or LPS-mediated activation of NF-kappa-B. Deubiquinates TRAF6 probably acting on 'Lys-63'-linked polyubiquitin. Upon T-cell receptor (TCR)-mediated T-cell activation, deubiquitinates 'Lys-63'-polyubiquitin chains on MALT1 thereby mediating disassociation of the CBM (CARD11:BCL10:MALT1) and IKK complexes and preventing sustained IKK activation. Deubiquinates NEMO/IKBKG; the function is facilitated by TNIP1 and leads to inhibition of NF-kappa-B activation. Upon stimulation by bacterial peptidoglycans, probably deubiquitinates RIPK2. Can also inhibit I-kappa-B-kinase (IKK) through a non-catalytic mechanism which involves polyubiquitin; polyubiquitin promotes association with IKBKG and prevents IKK MAP3K7-mediated phosphorylation. Targets TRAF2 for lysosomal degradation. In vitro able to deubiquitinate both 'Lys-48'- and 'Lys-63' polyubiquitin chains. Inhibitor of programmed cell death. Has a role in the function of the lymphoid system. Homodimer. Interacts with TNIP1, TAX1BP1 and TRAF2. Interacts with RNF11, ITCH and TAX1BP1 only after TNF stimulation; these interaction are transient and they are lost after 1 hour of stimulation with TNF. Interacts with YWHAZ and YWHAH. Interacts with IKBKG; the interaction is induced by TNF stimulation and by polyubiquitin. Interacts with RIPK1. Interacts with UBE2N; the interaction requires TAX1BP1. Interacts with TRAF6; the interaction is inhibited by HTLV-1 protein Tax. By TNF. Belongs to the peptidase C64 family.

Protein type: Ubiquitin conjugating system; EC 3.4.19.12; Apoptosis; Protease

Chromosomal Location of Human Ortholog: 6q23

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protease binding; protein binding; protein self-association; ubiquitin binding; ubiquitin-protein ligase activity; ubiquitin-specific protease activity

Biological Process: B-1 B cell homeostasis; inhibition of NF-kappaB transcription factor; negative regulation of B cell activation; negative regulation of I-kappaB kinase/NF-kappaB cascade; negative regulation of inflammatory response; negative regulation of innate immune response; negative regulation of interferon type I production; negative regulation of interleukin-2 production; negative regulation of interleukin-6 production; negative regulation of protein ubiquitination; negative regulation of smooth muscle cell proliferation; negative regulation of toll-like receptor 3 signaling pathway; negative regulation of tumor necrosis factor production; positive regulation of protein catabolic process; protein deubiquitination; regulation of germinal center formation; regulation of inflammatory response; response to molecule of bacterial origin

Disease: Autoinflammatory Syndrome, Familial, Behcet-like

Research Articles on TNFAIP3

Similar Products

Product Notes

The TNFAIP3 tnfaip3 (Catalog #AAA1267414) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgaac aagtccttcc tcaggctttg tatttgagca atatgcggaa agctgtgaag atacgggaga gaactccaga agacattttt aaacctacta atgggatcat tcatcatttt aaaaccatgc accgatacac actggaaatg ttcagaactt gccagttttg tcctcagttt cgggagatca tccacaaagc cctcatcgac agaaacatcc aggccaccct ggaaagccag aagaaactca actggtgtcg agaagtccgg aagcttgtgg cgctgaaaac gaacggtgac ggcaattgcc tcatgcatgc cacttctcag tacatgtggg gcgttcagga cacagacttg gtactgagga aggcgctgtt cagcacgctc aaggaaacag acacacgcaa ctttaaattc cgctggcaac tggagtctct caaatctcag gaatttgttg aaacggggct ttgctatgat actcggaact ggaatgatga atgggacaat cttatcaaaa tggcttccac agacacaccc atggcccgaa gtggacttca gtacaactca ctggaagaaa tacacatatt tgtcctttgc aacatcctca gaaggccaat cattgtcatt tcaggtgaga tgcctgcaga tcacggatct gtacttaaat gctttcagcc ttatgccttg gctcctggag aaaaccacac tgccaaagtt caggtaacag agttcaatgg aatttga. It is sometimes possible for the material contained within the vial of "TNFAIP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.