TMEM33 cdna clone
TMEM33 cDNA Clone
Gene Names
TMEM33; SHINC3; SHINC-3; 1600019D15Rik
Synonyms
TMEM33; TMEM33 cDNA Clone; TMEM33 cdna clone
Sequence
atggcagatacgaccccgaacggcccccaaggggcgggcgctgtgcaattcatgatgaccaataaactggacacggcaatgtggctttctcgcttgttcacagtttactgctctgctctgtttgttctgcctcttcttgggttgcatgaagcagcaagcttttaccaacgtgctttgctggcaaatgctcttaccagtgctctgaggctgcatcaaagattaccacacttccagttaagcagagcattcctggcccaggctttgttagaggacagctgccactacctgttgtattcactcatctttgtaaattcctatccagttacaatgagtatcttcccagtcttgttattctctttgcttcatgctgccacatatacgaaaaaggtccttgacgcaaggggctcaaatagtttacctctgctgagatctgtcttggacaaattaagtgctaatcaacaaaatattctgaaattcattgcttgcaatgaaatattcctgatgcctgcgacagtttttatgctttttagtggtcaaggaagtttgctccaaccttttatatactatagatttcttacccttcgatattcgtctcgaagaaacccatattgtcggaccttatttaatgaactgaggattgttgttgaacacataataatgaaacctgcttgcccactgtttgtgagaagactttgtctccagagcattgcctttataagcagattggcaccaacagttccatag
Sequence Length
744
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,978 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 33, mRNA
NCBI Official Synonym Full Names
transmembrane protein 33
NCBI Official Symbol
TMEM33
NCBI Official Synonym Symbols
SHINC3; SHINC-3; 1600019D15Rik
NCBI Protein Information
transmembrane protein 33
UniProt Protein Name
Transmembrane protein 33
Protein Family
UniProt Gene Name
TMEM33
UniProt Synonym Gene Names
DB83
UniProt Entry Name
TMM33_HUMAN
Uniprot Description
TMEM33: Belongs to the PER33/POM33 family.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 4p13
Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; melanosome; nuclear envelope; nuclear pore
Molecular Function: protein binding; structural constituent of nuclear pore
Biological Process: nuclear pore complex assembly
Research Articles on TMEM33
Similar Products
Product Notes
The TMEM33 tmem33 (Catalog #AAA1276600) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagata cgaccccgaa cggcccccaa ggggcgggcg ctgtgcaatt catgatgacc aataaactgg acacggcaat gtggctttct cgcttgttca cagtttactg ctctgctctg tttgttctgc ctcttcttgg gttgcatgaa gcagcaagct tttaccaacg tgctttgctg gcaaatgctc ttaccagtgc tctgaggctg catcaaagat taccacactt ccagttaagc agagcattcc tggcccaggc tttgttagag gacagctgcc actacctgtt gtattcactc atctttgtaa attcctatcc agttacaatg agtatcttcc cagtcttgtt attctctttg cttcatgctg ccacatatac gaaaaaggtc cttgacgcaa ggggctcaaa tagtttacct ctgctgagat ctgtcttgga caaattaagt gctaatcaac aaaatattct gaaattcatt gcttgcaatg aaatattcct gatgcctgcg acagttttta tgctttttag tggtcaagga agtttgctcc aaccttttat atactataga tttcttaccc ttcgatattc gtctcgaaga aacccatatt gtcggacctt atttaatgaa ctgaggattg ttgttgaaca cataataatg aaacctgctt gcccactgtt tgtgagaaga ctttgtctcc agagcattgc ctttataagc agattggcac caacagttcc atag. It is sometimes possible for the material contained within the vial of "TMEM33, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
