TMEM161A cdna clone
TMEM161A cDNA Clone
Gene Names
TMEM161A; AROS-29
Synonyms
TMEM161A; TMEM161A cDNA Clone; TMEM161A cdna clone
Sequence
atggcggtcctcggagtacagctggtggtgaccctgctcactgccaccctcatgcacaggctggcgccacactgctccttcgcgcgctggctgctctgtaacggcagtttgttccgatacaagcacccgtctgaggaggagcttcgggccctggcggggaagccgaggcccagaggcaggaaagagcggtgggccaatggccttagtgaggagaagccactgtctgtgccccgagatgccccgttccagctggagacctgccccctcacgaccgtggatgccctggtcctgcgcttcttcctggagtaccagtggtttgtggactttgctgtgtactcgggcggcgtgtacctcttcacagaggcctactactacatgctgggaccagccaaggagactaacattgctgtgttctggtgcctgctcacggtgaccttctccatcaagatgttcctgacagtgacacggctgtacttcagcgccgaggaggggggtgagcgctctgtctgcctcacctttgccttcctcttcctgctgctggccatgctggtgcaagtggtgcgggaggagaccctcgagctgggcctggagcctggtctggccagcatgacccagaacttagagccacttctgaagaagcagggctgggactgggcgcttcctgtggccaagctggctatccgcgtgggactggcagtggtgggctctgtgctgggtgccttcctcaccttcccaggcctgcggctggcccagacccaccgggacgcactgaccatgtcggaggacagacccatgctgcagttcctcctgcacaccagcttcctgtctcccctgttcatcctgtggctctggacaaagcccattgcacgggacttcctgcaccagccgccgtttggggagacgcgtttctccctgctgtccgattctgccttcgactctgggcgcctctggttgctggtggtgctgtgcctgctgcggctggcggtgacccggccccacctgcaggcctacctgtgcctggccaaggcccgggtggagcagctgcgaagggaggctggccgcatcgaagcccgtgaaatccagcagagggtggtccgagtctactgctatgtgaccgtggtgagcttgcagtacctgacgccgctcatcctcaccctcaactgcacacttctgctcaagacgctgggaggctattcctggggcctgggcccagctcctctactatcccccgacccatcctcagccagcgctgcccccatcggctctggggaggacgaagtccagcagactgcagcgcggattgccggggccctgggtggcctgcttactcccctcttcctccgtggcgtcctggcctacctcatctggtggacggctgcctgccagctgctcgccagccttttcggcctctacttccaccagcacttggcaggctcctag
Sequence Length
1440
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,632 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 161A, mRNA
NCBI Official Synonym Full Names
transmembrane protein 161A
NCBI Official Symbol
TMEM161A
NCBI Official Synonym Symbols
AROS-29
NCBI Protein Information
transmembrane protein 161A
UniProt Protein Name
Transmembrane protein 161A
UniProt Gene Name
TMEM161A
UniProt Synonym Gene Names
AROS-29
UniProt Entry Name
T161A_HUMAN
Uniprot Description
TMEM161A: Belongs to the TMEM161 family.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 19p13.11
Biological Process: positive regulation of DNA repair; response to retinoic acid
Research Articles on TMEM161A
Similar Products
Product Notes
The TMEM161A tmem161a (Catalog #AAA1273419) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtcc tcggagtaca gctggtggtg accctgctca ctgccaccct catgcacagg ctggcgccac actgctcctt cgcgcgctgg ctgctctgta acggcagttt gttccgatac aagcacccgt ctgaggagga gcttcgggcc ctggcgggga agccgaggcc cagaggcagg aaagagcggt gggccaatgg ccttagtgag gagaagccac tgtctgtgcc ccgagatgcc ccgttccagc tggagacctg ccccctcacg accgtggatg ccctggtcct gcgcttcttc ctggagtacc agtggtttgt ggactttgct gtgtactcgg gcggcgtgta cctcttcaca gaggcctact actacatgct gggaccagcc aaggagacta acattgctgt gttctggtgc ctgctcacgg tgaccttctc catcaagatg ttcctgacag tgacacggct gtacttcagc gccgaggagg ggggtgagcg ctctgtctgc ctcacctttg ccttcctctt cctgctgctg gccatgctgg tgcaagtggt gcgggaggag accctcgagc tgggcctgga gcctggtctg gccagcatga cccagaactt agagccactt ctgaagaagc agggctggga ctgggcgctt cctgtggcca agctggctat ccgcgtggga ctggcagtgg tgggctctgt gctgggtgcc ttcctcacct tcccaggcct gcggctggcc cagacccacc gggacgcact gaccatgtcg gaggacagac ccatgctgca gttcctcctg cacaccagct tcctgtctcc cctgttcatc ctgtggctct ggacaaagcc cattgcacgg gacttcctgc accagccgcc gtttggggag acgcgtttct ccctgctgtc cgattctgcc ttcgactctg ggcgcctctg gttgctggtg gtgctgtgcc tgctgcggct ggcggtgacc cggccccacc tgcaggccta cctgtgcctg gccaaggccc gggtggagca gctgcgaagg gaggctggcc gcatcgaagc ccgtgaaatc cagcagaggg tggtccgagt ctactgctat gtgaccgtgg tgagcttgca gtacctgacg ccgctcatcc tcaccctcaa ctgcacactt ctgctcaaga cgctgggagg ctattcctgg ggcctgggcc cagctcctct actatccccc gacccatcct cagccagcgc tgcccccatc ggctctgggg aggacgaagt ccagcagact gcagcgcgga ttgccggggc cctgggtggc ctgcttactc ccctcttcct ccgtggcgtc ctggcctacc tcatctggtg gacggctgcc tgccagctgc tcgccagcct tttcggcctc tacttccacc agcacttggc aggctcctag. It is sometimes possible for the material contained within the vial of "TMEM161A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
