Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

THOC6 cdna clone

THOC6 cDNA Clone

Gene Names
THOC6; BBIS; WDR58; fSAP35
Synonyms
THOC6; THOC6 cDNA Clone; THOC6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccatcttctcccagagcgtctcaccatgtgggaagtttctggcggctggcaacaattacgggcagattgccatcttcagcttgtcctctgctttgagctcagaagccaaagaggaaagtaagaagccggtggtgactttccaagcccatgatgggcccgtctatagcatggtttccaccgatcgacatctgcttagtgctggggatggggaggtgaaggcctggctttgggcggagatgctcaagaagggctgtaaggagctgtggcgtcgtcagcctccatacaggaccagcctggaagtgcctgagatcaacgctttgctgctggtccccaaggagaattccctcatcctggctgggggagactgtcagttgcacactatggaccttgaaactgggactttcacgagggtcctccggggccacacagactacatccactgcctggcactgcgggaaaggagcccagaggtgctgtcaggtggcgaggatggagctgttcgactttgggacctgcgcacagccaaggaggtccagacgatcgaggtctataagcacgaggagtgctcgaggccccacaatgggcgctggattggatgtttggcaactgattccgactggatggtctgtggagggggcccagccctcaccctctggcacctccgatcctccacacccaccaccatcttccccatccgggcgccacagaagcacgtcaccttctaccaggacctgattctgtcagctggccagggccgctgcgtcaaccagtggcagctgagcggggagctgaaggcccaggtgcctggctcctccccagggctgctcagcctcagcctcaaccagcagcctgccgcgcctgagtgcaaggtcctgacagctgcaggcaacagctgccgggtggatgtcttcaccaacctgggttaccgagccttctccctgtccttctga
Sequence Length
954
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,891 Da
NCBI Official Full Name
Homo sapiens THO complex 6 homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
THO complex 6
NCBI Official Symbol
THOC6
NCBI Official Synonym Symbols
BBIS; WDR58; fSAP35
NCBI Protein Information
THO complex subunit 6 homolog
UniProt Protein Name
THO complex subunit 6 homolog
Protein Family
UniProt Gene Name
THOC6
UniProt Synonym Gene Names
WDR58; fSAP35
UniProt Entry Name
THOC6_HUMAN

Uniprot Description

THOC6: Component of the THO subcomplex of the TREX complex. The TREX complex specifically associates with spliced mRNA and not with unspliced pre-mRNA. It is recruited to spliced mRNAs by a transcription-independent mechanism. Binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export. The recruitment occurs via an interaction between ALYREF/THOC4 and the cap-binding protein NCBP1. DDX39B functions as a bridge between ALYREF/THOC4 and the THO complex. The TREX complex is essential for the export of Kaposi's sarcoma-associated herpesvirus (KSHV) intronless mRNAs and infectious virus production. The recruitment of the TREX complex to the intronless viral mRNA occurs via an interaction between KSHV ORF57 protein and ALYREF/THOC4. Belongs to the WD repeat THOC6 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Spliceosome; RNA splicing

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: nuclear chromosome, telomeric region; nucleoplasm; nucleus

Biological Process: central nervous system development; intronless viral mRNA export from host nucleus; mRNA 3'-end processing; mRNA export from nucleus; negative regulation of apoptosis; RNA export from nucleus; termination of RNA polymerase II transcription

Disease: Beaulieu-boycott-innes Syndrome

Research Articles on THOC6

Similar Products

Product Notes

The THOC6 thoc6 (Catalog #AAA1268390) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccatct tctcccagag cgtctcacca tgtgggaagt ttctggcggc tggcaacaat tacgggcaga ttgccatctt cagcttgtcc tctgctttga gctcagaagc caaagaggaa agtaagaagc cggtggtgac tttccaagcc catgatgggc ccgtctatag catggtttcc accgatcgac atctgcttag tgctggggat ggggaggtga aggcctggct ttgggcggag atgctcaaga agggctgtaa ggagctgtgg cgtcgtcagc ctccatacag gaccagcctg gaagtgcctg agatcaacgc tttgctgctg gtccccaagg agaattccct catcctggct gggggagact gtcagttgca cactatggac cttgaaactg ggactttcac gagggtcctc cggggccaca cagactacat ccactgcctg gcactgcggg aaaggagccc agaggtgctg tcaggtggcg aggatggagc tgttcgactt tgggacctgc gcacagccaa ggaggtccag acgatcgagg tctataagca cgaggagtgc tcgaggcccc acaatgggcg ctggattgga tgtttggcaa ctgattccga ctggatggtc tgtggagggg gcccagccct caccctctgg cacctccgat cctccacacc caccaccatc ttccccatcc gggcgccaca gaagcacgtc accttctacc aggacctgat tctgtcagct ggccagggcc gctgcgtcaa ccagtggcag ctgagcgggg agctgaaggc ccaggtgcct ggctcctccc cagggctgct cagcctcagc ctcaaccagc agcctgccgc gcctgagtgc aaggtcctga cagctgcagg caacagctgc cgggtggatg tcttcaccaa cctgggttac cgagccttct ccctgtcctt ctga. It is sometimes possible for the material contained within the vial of "THOC6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.