Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYP cdna clone

SYP cDNA Clone

Gene Names
SYP; MRX96; MRXSYP
Synonyms
SYP; SYP cDNA Clone; SYP cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgctggcggacatggacgtggtgaatcagctggtggctgggggtcagttccgggtggtcaaggagcccctcggctttgtgaaggtgctgcaatgggtcttcgccatcttcgcctttgccacatgcggcagctacagtggggagctccagctgagcgtggattgtgccaacaagaccgagagtgacctcagcatcgaggtcgagttcgagtaccccttcaggctgcaccaagtgtactttgatgcacccacctgccgagggggcaccaccaaggtcttcttagttggggactactcctcgtcagccgaattctttgtcaccgtggccgtgtttgccttcctctactccatgggggctctggccacctacatcttcctgcagaacaagtaccgagagaataacaaagggcccatgctggactttctggccacggctgtgttcgccttcatgtggctagttagctcatcggcatgggccaaggggctgtcagatgtgaagatggccacagacccagagaacattatcaaggagatgcctgtctgccgccagacagggaacacatgcaaggagctgagagaccttgtgacctcgggactcaacacctcggtggtgttcggcttcctgaacctggtgctctgggtcggcaacctgtggttcgtgtttaaggagacaggctgggccgccccgttcctgcgcgcgcctcccggcgcccccgagaaacaaccggcacccggggacgcctacggcgatgcaggctacgggcagggccccggcgggtacgggccccaggattcctacgggcctcagggcggctaccagcctgactatggtcaaccagccggcagcggtggcagtggctacgggcctcagggcgactatgggcagcaaggctacggcccgcagggtgcacccacctccttctccaatcagatgtag
Sequence Length
942
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,757 Da
NCBI Official Full Name
Homo sapiens synaptophysin, mRNA
NCBI Official Synonym Full Names
synaptophysin
NCBI Official Symbol
SYP
NCBI Official Synonym Symbols
MRX96; MRXSYP
NCBI Protein Information
synaptophysin
UniProt Protein Name
Synaptophysin
Protein Family
UniProt Gene Name
SYP
UniProt Entry Name
SYPH_HUMAN

NCBI Description

This gene encodes an integral membrane protein of small synaptic vesicles in brain and endocrine cells. The protein also binds cholesterol and is thought to direct targeting of vesicle-associated membrane protein 2 (synaptobrevin) to intracellular compartments. Mutations in this gene are associated with X-linked mental retardation (XLMR). [provided by RefSeq, Aug 2011]

Uniprot Description

SYP: Possibly involved in structural functions as organizing other membrane components or in targeting the vesicles to the plasma membrane. Involved in the regulation of short-term and long-term synaptic plasticity. Homohexamer or homotetramer. Interacts with SRCIN1. Characteristic of a type of small (30-80 nm) neurosecretory vesicles, including presynaptic vesicles, but also vesicles of various neuroendocrine cells of both neuronal and epithelial phenotype. Belongs to the synaptophysin/synaptobrevin family.

Protein type: Vesicle; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: Xp11.23-p11.22

Cellular Component: integral to synaptic vesicle membrane; neuron projection; synaptic vesicle

Molecular Function: cholesterol binding; protein self-association

Biological Process: endocytosis; regulation of long-term neuronal synaptic plasticity; regulation of neuronal synaptic plasticity; regulation of short-term neuronal synaptic plasticity

Disease: Mental Retardation, X-linked 96

Research Articles on SYP

Similar Products

Product Notes

The SYP syp (Catalog #AAA1265978) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgc tggcggacat ggacgtggtg aatcagctgg tggctggggg tcagttccgg gtggtcaagg agcccctcgg ctttgtgaag gtgctgcaat gggtcttcgc catcttcgcc tttgccacat gcggcagcta cagtggggag ctccagctga gcgtggattg tgccaacaag accgagagtg acctcagcat cgaggtcgag ttcgagtacc ccttcaggct gcaccaagtg tactttgatg cacccacctg ccgagggggc accaccaagg tcttcttagt tggggactac tcctcgtcag ccgaattctt tgtcaccgtg gccgtgtttg ccttcctcta ctccatgggg gctctggcca cctacatctt cctgcagaac aagtaccgag agaataacaa agggcccatg ctggactttc tggccacggc tgtgttcgcc ttcatgtggc tagttagctc atcggcatgg gccaaggggc tgtcagatgt gaagatggcc acagacccag agaacattat caaggagatg cctgtctgcc gccagacagg gaacacatgc aaggagctga gagaccttgt gacctcggga ctcaacacct cggtggtgtt cggcttcctg aacctggtgc tctgggtcgg caacctgtgg ttcgtgttta aggagacagg ctgggccgcc ccgttcctgc gcgcgcctcc cggcgccccc gagaaacaac cggcacccgg ggacgcctac ggcgatgcag gctacgggca gggccccggc gggtacgggc cccaggattc ctacgggcct cagggcggct accagcctga ctatggtcaa ccagccggca gcggtggcag tggctacggg cctcagggcg actatgggca gcaaggctac ggcccgcagg gtgcacccac ctccttctcc aatcagatgt ag. It is sometimes possible for the material contained within the vial of "SYP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.