SPNS1 cdna clone
SPNS1 cDNA Clone
Gene Names
SPNS1; LAT; nrs; SPIN1; SPINL; HSpin1; PP2030
Synonyms
SPNS1; SPNS1 cDNA Clone; SPNS1 cdna clone
Sequence
atggccgggtccgacaccgcgcccttcctcagccaggcggatgacccggacgacgggccagtgcctggcaccccggggttgccagggtccacggggaacccgaagtccgaggagcccgaggtcccggaccaggaggggctgcagcgcatcaccggcctgtctcccggccgttcggctctcatagtggcggtgctgtgctacatcaatctcctgaactacatggaccgcttcaccgtggctggcgtccttcccgacatcgagcagttcttcaacatcggggacagtagctctgggctcatccagaccgtgttcatctccagttacatggtgttggcacctgtgtttggctacctgggtgacaggtacaatcggaagtatctcatgtgcgggggcattgccttctggtccctggtgacactggggtcatccttcatccccggagagcatttctggctgctcctcctgacccggggcctggtgggggtcggggaggccagttattccaccatcgcgcccactctcattgccgacctctttgtggccgaccagcggagccggatgctcagcatcttctactttgccattccggtgggcagtggtctgggctacattgcaggctccaaagtgaaggatatggctggagactggcactgggctctgagggtgacaccgggtctaggagtggtggccgttctgctgctgttcctggtagtgcgggagccgccaaggggagccgtggagcgccactcagatttgccacccctgaaccccacctcgtggtgggcagatctgagggctctggcaagaaatcctagtttcgtcctgtcttccctgggcttcactgctgtggcctttgtcacgggctccctggctctgtgggctccggcattcctgctgcgttcccgcgtggtccttggggagaccccaccctgccttcccggagactcctgctcttcctctgacagtctcatctttggactcatcacctgcctgaccggagtcctgggtgtgggcctgggtgtggagatcagccgccggctccgccactccaacccccgggctgatcccctggtctgtgccactggcctcctgggctctgcacccttcctcttcctgtcccttgcctgcgcccgtggtagcatcgtggccacttatattttcatcttcattggagagaccctcctgtccatgaactgggccatcgtggccgacattctgctgtacgtggtgatccctacccgacgctccaccgccgaggccttccagatcgtgctgtcccacctgctgggtgatgctgggagcccctacctcattggcctgatctctgaccgcctgcgccggaactggcccccctccttcttgtccgagttccgggctctgcagttctcgctcatgctctgcgcgtttgttggggcactgggcggcgcagccttcctgggcaccgccatcttcattgaggccgaccgccggcgggcacagctgcacgtgcagggcctgctgcacgaagcagggtccacagacgaccggattgtggtgccccagcggggccgctccacccgcgtgcccgtggccagtgtgctcatctga
Sequence Length
1587
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,594 Da
NCBI Official Full Name
Homo sapiens spinster homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
sphingolipid transporter 1 (putative)
NCBI Official Symbol
SPNS1
NCBI Official Synonym Symbols
LAT; nrs; SPIN1; SPINL; HSpin1; PP2030
NCBI Protein Information
protein spinster homolog 1
UniProt Protein Name
Protein spinster homolog 1
Protein Family
UniProt Gene Name
SPNS1
UniProt Synonym Gene Names
SPIN1
UniProt Entry Name
SPNS1_HUMAN
Uniprot Description
SPNS1: Sphingolipid transporter. May be involved in necrotic or autophagic cell death. Belongs to the major facilitator (TC 2.A.1) superfamily. Spinster (TC 2.A.1.49) family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Mitochondrial; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 16p11.2
Cellular Component: lysosomal membrane; vesicle
Molecular Function: protein binding; sphingolipid transporter activity
Biological Process: locomotion
Research Articles on SPNS1
Similar Products
Product Notes
The SPNS1 spns1 (Catalog #AAA1267812) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgggt ccgacaccgc gcccttcctc agccaggcgg atgacccgga cgacgggcca gtgcctggca ccccggggtt gccagggtcc acggggaacc cgaagtccga ggagcccgag gtcccggacc aggaggggct gcagcgcatc accggcctgt ctcccggccg ttcggctctc atagtggcgg tgctgtgcta catcaatctc ctgaactaca tggaccgctt caccgtggct ggcgtccttc ccgacatcga gcagttcttc aacatcgggg acagtagctc tgggctcatc cagaccgtgt tcatctccag ttacatggtg ttggcacctg tgtttggcta cctgggtgac aggtacaatc ggaagtatct catgtgcggg ggcattgcct tctggtccct ggtgacactg gggtcatcct tcatccccgg agagcatttc tggctgctcc tcctgacccg gggcctggtg ggggtcgggg aggccagtta ttccaccatc gcgcccactc tcattgccga cctctttgtg gccgaccagc ggagccggat gctcagcatc ttctactttg ccattccggt gggcagtggt ctgggctaca ttgcaggctc caaagtgaag gatatggctg gagactggca ctgggctctg agggtgacac cgggtctagg agtggtggcc gttctgctgc tgttcctggt agtgcgggag ccgccaaggg gagccgtgga gcgccactca gatttgccac ccctgaaccc cacctcgtgg tgggcagatc tgagggctct ggcaagaaat cctagtttcg tcctgtcttc cctgggcttc actgctgtgg cctttgtcac gggctccctg gctctgtggg ctccggcatt cctgctgcgt tcccgcgtgg tccttgggga gaccccaccc tgccttcccg gagactcctg ctcttcctct gacagtctca tctttggact catcacctgc ctgaccggag tcctgggtgt gggcctgggt gtggagatca gccgccggct ccgccactcc aacccccggg ctgatcccct ggtctgtgcc actggcctcc tgggctctgc acccttcctc ttcctgtccc ttgcctgcgc ccgtggtagc atcgtggcca cttatatttt catcttcatt ggagagaccc tcctgtccat gaactgggcc atcgtggccg acattctgct gtacgtggtg atccctaccc gacgctccac cgccgaggcc ttccagatcg tgctgtccca cctgctgggt gatgctggga gcccctacct cattggcctg atctctgacc gcctgcgccg gaactggccc ccctccttct tgtccgagtt ccgggctctg cagttctcgc tcatgctctg cgcgtttgtt ggggcactgg gcggcgcagc cttcctgggc accgccatct tcattgaggc cgaccgccgg cgggcacagc tgcacgtgca gggcctgctg cacgaagcag ggtccacaga cgaccggatt gtggtgcccc agcggggccg ctccacccgc gtgcccgtgg ccagtgtgct catctga. It is sometimes possible for the material contained within the vial of "SPNS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
