Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SORD cdna clone

SORD cDNA Clone

Gene Names
SORD; SORD1; HEL-S-95n
Synonyms
SORD; SORD cDNA Clone; SORD cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcggccaagcccaacaacctttccctggtggtgcacggaccgggggacttgcgcctggagaactatcctatccctgaaccaggcccaaatgaggtcttgctgaggatgcattctgttggaatctgtggctcagatgtccactactgggagtatggtcgaattgggaattttattgtgaaaaagcccatggtgctgggacatgaagcttcgggaacagtcgaaaaagtgggatcatcggtaaagcacctaaaaccaggtgatcgtgttgccatcgagcctggtgctccccgagaaaatgatgaattctgcaagatgggccgatacaatctgtcaccttccatcttcttctgtgccacgccccccgatgacgggaacctctgccggttctataagcacaatgcagccttttgttacaagcttcctgacaatgtcacctttgaggaaggcgccctgatcgagccactttctgtggggatccatgcctgcaggagaggcggagttaccctgggacacaaggtccttgtgtgtggagctgggccaatcgggatggtcactttgctcgtggccaaagcaatgggagcagctcaagtagtggtgactgatctgtctgctacccgattgtccaaagccaaggagattggggctgatttagtcctccagatctccaaggagagccctcaggaaatcgccaggaaagtagaaggtcagctggggtgcaagccggaagtcaccatcgagtgcacgggggcagaggcctccatccaggcgggcatctacgccactcgctctggtgggaccctcgtgcttgtggggctgggctctgagatgaccaccgtacccctactgcatgcagccatccgggaggtggatatcaagggcgtgtttcgatactgcaacacgtggccagtggcgatttcgatgcttgcgtccaagtctgtgaatgtaaaacccctcgtcacccataggtttcctctggagaaagctctggaggcctttgaaacatttaaaaagggattggggttgaaaatcatgctcaagtgtgaccccagtgaccagaatccctga
Sequence Length
1074
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,812 Da
NCBI Official Full Name
Homo sapiens sorbitol dehydrogenase, mRNA
NCBI Official Synonym Full Names
sorbitol dehydrogenase
NCBI Official Symbol
SORD
NCBI Official Synonym Symbols
SORD1; HEL-S-95n
NCBI Protein Information
sorbitol dehydrogenase
UniProt Protein Name
Sorbitol dehydrogenase
UniProt Gene Name
SORD
UniProt Entry Name
DHSO_HUMAN

NCBI Description

Sorbitol dehydrogenase (SORD; EC 1.1.1.14) catalyzes the interconversion of polyols and their corresponding ketoses, and together with aldose reductase (ALDR1; MIM 103880), makes up the sorbitol pathway that is believed to play an important role in the development of diabetic complications (summarized by Carr and Markham, 1995 [PubMed 8535074]). The first reaction of the pathway (also called the polyol pathway) is the reduction of glucose to sorbitol by ALDR1 with NADPH as the cofactor. SORD then oxidizes the sorbitol to fructose using NAD(+) cofactor.[supplied by OMIM, Jul 2010]

Uniprot Description

SORD: Converts sorbitol to fructose. Part of the polyol pathway that plays an important role in sperm physiology. May play a role in the sperm motility by providing an energetic source for sperm. Belongs to the zinc-containing alcohol dehydrogenase family.

Protein type: Oxidoreductase; Carbohydrate Metabolism - fructose and mannose; EC 1.1.1.14

Chromosomal Location of Human Ortholog: 15q15.3

Cellular Component: cytosol; extracellular space; membrane

Molecular Function: D-xylulose reductase activity; L-iditol 2-dehydrogenase activity; NAD binding; zinc ion binding

Biological Process: fructose biosynthetic process; glucose metabolic process; glucuronate catabolic process to xylulose 5-phosphate; L-xylitol catabolic process; L-xylitol metabolic process; sorbitol catabolic process; sperm motility

Research Articles on SORD

Similar Products

Product Notes

The SORD sord (Catalog #AAA1274808) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cggccaagcc caacaacctt tccctggtgg tgcacggacc gggggacttg cgcctggaga actatcctat ccctgaacca ggcccaaatg aggtcttgct gaggatgcat tctgttggaa tctgtggctc agatgtccac tactgggagt atggtcgaat tgggaatttt attgtgaaaa agcccatggt gctgggacat gaagcttcgg gaacagtcga aaaagtggga tcatcggtaa agcacctaaa accaggtgat cgtgttgcca tcgagcctgg tgctccccga gaaaatgatg aattctgcaa gatgggccga tacaatctgt caccttccat cttcttctgt gccacgcccc ccgatgacgg gaacctctgc cggttctata agcacaatgc agccttttgt tacaagcttc ctgacaatgt cacctttgag gaaggcgccc tgatcgagcc actttctgtg gggatccatg cctgcaggag aggcggagtt accctgggac acaaggtcct tgtgtgtgga gctgggccaa tcgggatggt cactttgctc gtggccaaag caatgggagc agctcaagta gtggtgactg atctgtctgc tacccgattg tccaaagcca aggagattgg ggctgattta gtcctccaga tctccaagga gagccctcag gaaatcgcca ggaaagtaga aggtcagctg gggtgcaagc cggaagtcac catcgagtgc acgggggcag aggcctccat ccaggcgggc atctacgcca ctcgctctgg tgggaccctc gtgcttgtgg ggctgggctc tgagatgacc accgtacccc tactgcatgc agccatccgg gaggtggata tcaagggcgt gtttcgatac tgcaacacgt ggccagtggc gatttcgatg cttgcgtcca agtctgtgaa tgtaaaaccc ctcgtcaccc ataggtttcc tctggagaaa gctctggagg cctttgaaac atttaaaaag ggattggggt tgaaaatcat gctcaagtgt gaccccagtg accagaatcc ctga. It is sometimes possible for the material contained within the vial of "SORD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.