Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMG6 cdna clone

SMG6 cDNA Clone

Gene Names
SMG6; EST1A; SMG-6; C17orf31; hSMG5/7a
Synonyms
SMG6; SMG6 cDNA Clone; SMG6 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacattccctgcagtggctgagaaggtcctcaaggagttccaggtgttactgcagcacagcccctctcccattggaagtacccgcatgctgcagcttatgaccatcaatatgtttgcagtacacaactcccagctgaaagactgcttctcggaggagtgccgctctgtgatccaggaacaagccgcagctctgggcttggccatgttttctctactggtccgccgctgcacctgcttacttaaggagtccgccaaagctcagctgtcctctcctgaggaccaggatgaccaagacgacatcaaggtgtcttcctttgtcccggacctgaaggagctgctccccagtgtcaaagtctggtcagattggatgctcggctacccggacacctggaatcctcctcccacatccctggatctgccctcgcatgttgctgtggatgtatggtcgacgctggctgatttctgtaacatactgactgcagtgaatcagtctgaggtgccactgtacaaggacccggatgatgacctcacccttcttatcctggaagaggatcggcttctctcgggctttgtccccttgctggctgcccctcaggacccctgctacgtggagaaaacctcggataaggttattgcagctgactgcaaaagggtcacagtgctgaagtattttctggaagccctttgtggacaagaagagcctctgctggcattcaagggtggaaagtatgtgtcagtggcacccgtcccagacaccatgggaaaggaaatgggaagccaagagggaacacgactggaagatgaggaggaggatgtggtgattgaagactttgaggaagattcagaggctgaaggcagcggaggcgaggatgacatcagggagcttcgggccaagaagctggctctggccaggaagatagctgagcagcagcgtcgccaggaaaagatccaggctgtcctggaggaccacagtcagatgaggcagatggagctcgaaatcagacctttgttcctcgtaccagacaccaacggcttcattgaccacctggccagtctggcgcggctgctggagagcaggaagtacatcctggtggtgcccctcatcgtgatcaatgagctggacggcctggccaaggggcaggagacagaccaccgggctgggggctacgcccgtgtggtacaagagaaggcccgcaagtccatcgagttcctcgagcagcgattcgagagtcgggactcttgcctgcgagccctgaccagccgtggcaatgaactcgaatccatcgccttccgcagtgaggacatcactggccagctgggtaacaacgatgatctcatcctgtcctgctgcctccactactgcaaagacaaggctaaggacttcatgcccgccagcaaagaggagccaatccggctactgcgggaggtggtgctgttgacggatgaccggaacctgcgtgtgaaggcgctcacaaggaatgttcctgtacgggacatcccagccttcctcacgtgggcccaggtgggctga
Sequence Length
1536
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,455 Da
NCBI Official Full Name
Homo sapiens Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans), mRNA
NCBI Official Synonym Full Names
SMG6, nonsense mediated mRNA decay factor
NCBI Official Symbol
SMG6
NCBI Official Synonym Symbols
EST1A; SMG-6; C17orf31; hSMG5/7a
NCBI Protein Information
telomerase-binding protein EST1A
UniProt Protein Name
Telomerase-binding protein EST1A
UniProt Gene Name
SMG6
UniProt Synonym Gene Names
C17orf31; EST1A; KIAA0732
UniProt Entry Name
EST1A_HUMAN

NCBI Description

This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]

Uniprot Description

EST1A: Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. May have a general role in telomere regulation. Promotes in vitro the ability of TERT to elongate telomeres. Overexpression induces telomere uncapping, chromosomal end-to-end fusions (telomeric DNA persists at the fusion points) and did not perturb TRF2 telomeric localization. Binds to the single-stranded 5'- (GTGTGG)(4)GTGT-3' telomeric DNA, but not to a telomerase RNA template component (TER). 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; Nucleolus; DNA-binding; EC 3.1.-.-

Chromosomal Location of Human Ortholog: 17p13.3

Cellular Component: cytoplasm; cytosol; nucleolus; nucleus; telomerase holoenzyme complex

Molecular Function: endoribonuclease activity; protein binding; ribonucleoprotein binding; telomeric DNA binding

Biological Process: mRNA catabolic process, nonsense-mediated decay; mRNA export from nucleus; regulation of dephosphorylation; regulation of telomere maintenance via telomerase; telomere maintenance

Research Articles on SMG6

Similar Products

Product Notes

The SMG6 smg6 (Catalog #AAA1275633) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacat tccctgcagt ggctgagaag gtcctcaagg agttccaggt gttactgcag cacagcccct ctcccattgg aagtacccgc atgctgcagc ttatgaccat caatatgttt gcagtacaca actcccagct gaaagactgc ttctcggagg agtgccgctc tgtgatccag gaacaagccg cagctctggg cttggccatg ttttctctac tggtccgccg ctgcacctgc ttacttaagg agtccgccaa agctcagctg tcctctcctg aggaccagga tgaccaagac gacatcaagg tgtcttcctt tgtcccggac ctgaaggagc tgctccccag tgtcaaagtc tggtcagatt ggatgctcgg ctacccggac acctggaatc ctcctcccac atccctggat ctgccctcgc atgttgctgt ggatgtatgg tcgacgctgg ctgatttctg taacatactg actgcagtga atcagtctga ggtgccactg tacaaggacc cggatgatga cctcaccctt cttatcctgg aagaggatcg gcttctctcg ggctttgtcc ccttgctggc tgcccctcag gacccctgct acgtggagaa aacctcggat aaggttattg cagctgactg caaaagggtc acagtgctga agtattttct ggaagccctt tgtggacaag aagagcctct gctggcattc aagggtggaa agtatgtgtc agtggcaccc gtcccagaca ccatgggaaa ggaaatggga agccaagagg gaacacgact ggaagatgag gaggaggatg tggtgattga agactttgag gaagattcag aggctgaagg cagcggaggc gaggatgaca tcagggagct tcgggccaag aagctggctc tggccaggaa gatagctgag cagcagcgtc gccaggaaaa gatccaggct gtcctggagg accacagtca gatgaggcag atggagctcg aaatcagacc tttgttcctc gtaccagaca ccaacggctt cattgaccac ctggccagtc tggcgcggct gctggagagc aggaagtaca tcctggtggt gcccctcatc gtgatcaatg agctggacgg cctggccaag gggcaggaga cagaccaccg ggctgggggc tacgcccgtg tggtacaaga gaaggcccgc aagtccatcg agttcctcga gcagcgattc gagagtcggg actcttgcct gcgagccctg accagccgtg gcaatgaact cgaatccatc gccttccgca gtgaggacat cactggccag ctgggtaaca acgatgatct catcctgtcc tgctgcctcc actactgcaa agacaaggct aaggacttca tgcccgccag caaagaggag ccaatccggc tactgcggga ggtggtgctg ttgacggatg accggaacct gcgtgtgaag gcgctcacaa ggaatgttcc tgtacgggac atcccagcct tcctcacgtg ggcccaggtg ggctga. It is sometimes possible for the material contained within the vial of "SMG6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.