Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLIT1 cdna clone

SLIT1 cDNA Clone

Gene Names
SLIT1; MEGF4; SLIL1; SLIT3; SLIT-1
Synonyms
SLIT1; SLIT1 cDNA Clone; SLIT1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCGCTGACTCCCGGGTGGGGGTCCTCGGCGGGGCCGGTCCGGCCGGAGCTCTGGCTGCTGCTGTGGGCAGCCGCGTGGCGCCTGGGTGCCTCGGCGTGCCCCGCCCTCTGCACCTGCACCGGAACCACGGTGGACTGCCACGGCACGGGGCTGCAGGCCATTCCCAAGAATATACCTCGGAACACCGAGCGCCTGTGA
Sequence Length
201
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,633 Da
NCBI Official Full Name
Homo sapiens slit homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
slit guidance ligand 1
NCBI Official Symbol
SLIT1
NCBI Official Synonym Symbols
MEGF4; SLIL1; SLIT3; SLIT-1
NCBI Protein Information
slit homolog 1 protein
UniProt Protein Name
Slit homolog 1 protein
Protein Family
UniProt Gene Name
SLIT1
UniProt Synonym Gene Names
KIAA0813; MEGF4; SLIL1; Slit-1; Multiple EGF-like domains protein 4
UniProt Entry Name
SLIT1_HUMAN

Uniprot Description

SLIT1: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 together seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 10q23.3-q24

Cellular Component: extracellular space; proteinaceous extracellular matrix

Molecular Function: heparin binding; Roundabout binding

Biological Process: axon extension involved in axon guidance; axon guidance; chemorepulsion involved in embryonic olfactory bulb interneuron migration; motor axon guidance; negative chemotaxis; negative regulation of synaptogenesis; regulation of axonogenesis

Research Articles on SLIT1

Similar Products

Product Notes

The SLIT1 slit1 (Catalog #AAA1265626) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCGCTGA CTCCCGGGTG GGGGTCCTCG GCGGGGCCGG TCCGGCCGGA GCTCTGGCTG CTGCTGTGGG CAGCCGCGTG GCGCCTGGGT GCCTCGGCGT GCCCCGCCCT CTGCACCTGC ACCGGAACCA CGGTGGACTG CCACGGCACG GGGCTGCAGG CCATTCCCAA GAATATACCT CGGAACACCG AGCGCCTGTG A. It is sometimes possible for the material contained within the vial of "SLIT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.