SLC6A13 cdna clone
SLC6A13 cDNA Clone
Synonyms
SLC6A13; SLC6A13 cDNA Clone; SLC6A13 cdna clone
Sequence
atggatagcagggtctcaggcacaaccagtaatggagagacaaaaccagtgtatccagtcatggaaaagaaggaggaagatggcaccctggagcgggggcactggaacaacaagatggagtttgtgctgtcagtggctggggagatcattggcttaggcaacgtctggaggtttccctatctctgctacaaaaatgggggaggtgccttcttcatcccctacctcgtcttcctctttacctgtggcattcctgtcttccttctggagacagcactaggccagtacactagccagggaggcgtcacagcctggaggaagatctgccccatctttgagggcattggctatgcctcccagatgatcgtcatcctcctcaacgtctactacatcattgtgttggcctgggccctgttctacctcttcagcagcttcaccatcgacctgccctggggcggctgctaccatgagtggaacacagaacactgtatggagttccagaagaccaacggctccctgaatggtacctctgagaatgccacctctcctgtcatcgagttctgggagcggcgggtcttgaagatctctgatgggatccagcacctgggggccctgcgctgggagctggctctgtgcctcctgctggcctgggtcatctgctacttctgcatctggaagggggtgaagtccacaggcaaggtggtgtacttcacggccacatttccttacctcatgctggtggtcctgttaattcgaggggtgacgttgcctggggcagcccaaggaattcagttttacctgtacccaaacctcacgcgtctgtgggatccccaggtgtggatggatgcaggcacccagatattcttctccttcgccatctgtcttgggtgcctgacagccctgggcagctacaacaagtaccacaacaactgctacagggactgcatcgccctctgcttcctcaacagcggcaccagctttgtggccggctttgccatcttctccatcctgggcttcatgtctcaggagcagggggtgcccatttctgaggtggccgagtcaggccctggcctggctttcatcgcttacccgcgggctgtggtgatgctgcccttctctcctctctgggcctgctgtttcttcttcatggtcgttctcctgggactggatagccagtttgtgtgtgtagaaagcctggtgacagcgctggtggacatgtaccctcacgtgttccgcaagaagaaccggagggaagtcctcatccttggagtatctgtcgtctccttccttgtggggctgatcatgctcacagagggcggaatgtacgtgttccagctctttgactactatgcggccagtggcatgtgcctcctgttcgtggccatcttcgagtccctctgtgtggcttgggtttacggagccaagcgcttctacgacaacatcgaagacatgattgggtacaggccatggcctcttatcaaatactgttggctcttcctcacaccagctgtgtgcacagccacctttctcttctccctgataaagtacactccgctgacctacaacaagaagtacacgtacccgtggtggggcgatgccctgggctggctcctggctctgtcctccatggtctgcattcctgcctggagcctctacagactcggaaccctcaagggccccttcagagagagaatccgtcagctcatgtgcccagccgaggacttgccccagcggaacccagcaggaccctcggctcccgccacccccaggacctcactgctcagactcacagagctagagtctcactgctag
Sequence Length
1809
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
10,910 Da
NCBI Official Full Name
Homo sapiens solute carrier family 6 (neurotransmitter transporter, GABA), member 13, mRNA
UniProt Protein Name
Sodium- and chloride-dependent GABA transporter 2
Protein Family
UniProt Gene Name
SLC6A13
UniProt Synonym Gene Names
GAT2; GAT-2
UniProt Entry Name
S6A13_HUMAN
Uniprot Description
SLC6A13: Terminates the action of GABA by its high affinity sodium-dependent reuptake into presynaptic terminals. Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family. SLC6A13 subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transporter; Membrane protein, multi-pass; Membrane protein, integral; Transporter, SLC family
Chromosomal Location of Human Ortholog: 12p13.3
Cellular Component: integral to plasma membrane; neuron projection; plasma membrane
Molecular Function: gamma-aminobutyric acid:sodium symporter activity
Biological Process: gamma-aminobutyric acid transport; neurotransmitter transport; synaptic transmission
Similar Products
Product Notes
The SLC6A13 slc6a13 (Catalog #AAA1269317) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatagca gggtctcagg cacaaccagt aatggagaga caaaaccagt gtatccagtc atggaaaaga aggaggaaga tggcaccctg gagcgggggc actggaacaa caagatggag tttgtgctgt cagtggctgg ggagatcatt ggcttaggca acgtctggag gtttccctat ctctgctaca aaaatggggg aggtgccttc ttcatcccct acctcgtctt cctctttacc tgtggcattc ctgtcttcct tctggagaca gcactaggcc agtacactag ccagggaggc gtcacagcct ggaggaagat ctgccccatc tttgagggca ttggctatgc ctcccagatg atcgtcatcc tcctcaacgt ctactacatc attgtgttgg cctgggccct gttctacctc ttcagcagct tcaccatcga cctgccctgg ggcggctgct accatgagtg gaacacagaa cactgtatgg agttccagaa gaccaacggc tccctgaatg gtacctctga gaatgccacc tctcctgtca tcgagttctg ggagcggcgg gtcttgaaga tctctgatgg gatccagcac ctgggggccc tgcgctggga gctggctctg tgcctcctgc tggcctgggt catctgctac ttctgcatct ggaagggggt gaagtccaca ggcaaggtgg tgtacttcac ggccacattt ccttacctca tgctggtggt cctgttaatt cgaggggtga cgttgcctgg ggcagcccaa ggaattcagt tttacctgta cccaaacctc acgcgtctgt gggatcccca ggtgtggatg gatgcaggca cccagatatt cttctccttc gccatctgtc ttgggtgcct gacagccctg ggcagctaca acaagtacca caacaactgc tacagggact gcatcgccct ctgcttcctc aacagcggca ccagctttgt ggccggcttt gccatcttct ccatcctggg cttcatgtct caggagcagg gggtgcccat ttctgaggtg gccgagtcag gccctggcct ggctttcatc gcttacccgc gggctgtggt gatgctgccc ttctctcctc tctgggcctg ctgtttcttc ttcatggtcg ttctcctggg actggatagc cagtttgtgt gtgtagaaag cctggtgaca gcgctggtgg acatgtaccc tcacgtgttc cgcaagaaga accggaggga agtcctcatc cttggagtat ctgtcgtctc cttccttgtg gggctgatca tgctcacaga gggcggaatg tacgtgttcc agctctttga ctactatgcg gccagtggca tgtgcctcct gttcgtggcc atcttcgagt ccctctgtgt ggcttgggtt tacggagcca agcgcttcta cgacaacatc gaagacatga ttgggtacag gccatggcct cttatcaaat actgttggct cttcctcaca ccagctgtgt gcacagccac ctttctcttc tccctgataa agtacactcc gctgacctac aacaagaagt acacgtaccc gtggtggggc gatgccctgg gctggctcct ggctctgtcc tccatggtct gcattcctgc ctggagcctc tacagactcg gaaccctcaa gggccccttc agagagagaa tccgtcagct catgtgccca gccgaggact tgccccagcg gaacccagca ggaccctcgg ctcccgccac ccccaggacc tcactgctca gactcacaga gctagagtct cactgctag. It is sometimes possible for the material contained within the vial of "SLC6A13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
