Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SH2D1A cdna clone

SH2D1A cDNA Clone

Gene Names
SH2D1A; LYP; SAP; XLP; DSHP; EBVS; IMD5; XLPD; MTCP1; XLPD1; SAP/SH2D1A
Synonyms
SH2D1A; SH2D1A cDNA Clone; SH2D1A cdna clone
Ordering
For Research Use Only!
Sequence
atggacgcagtggctgtgtatcatggcaaaatcagcagggaaaccggcgagaagctcctgcttgccactgggctggatggcagctatttgctgagggacagcgagagcgtgccaggcgtgtactgcctatgtgtgctgtatcacggttacatttatacataccgagtgtcccagacagaaacaggttcttggagtgctgagacagcacctggggtacataaaagatatttccggaaaataaaaaatctcatttcagcatttcagaagccagatcaaggcattgtaatacctctgcagtatccagttgagaagaagtcctcagctagaagtacacaaggtactacagggataagagaagatcctgatgtctgcctgaaagccccatga
Sequence Length
387
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
6,631 Da
NCBI Official Full Name
Homo sapiens SH2 domain protein 1A, mRNA
NCBI Official Synonym Full Names
SH2 domain containing 1A
NCBI Official Symbol
SH2D1A
NCBI Official Synonym Symbols
LYP; SAP; XLP; DSHP; EBVS; IMD5; XLPD; MTCP1; XLPD1; SAP/SH2D1A
NCBI Protein Information
SH2 domain-containing protein 1A
UniProt Protein Name
SH2 domain-containing protein 1A
UniProt Gene Name
SH2D1A
UniProt Synonym Gene Names
DSHP; SAP; SLAM-associated protein
UniProt Entry Name
SH21A_HUMAN

NCBI Description

This gene encodes a protein that plays a major role in the bidirectional stimulation of T and B cells. This protein contains an SH2 domain and a short tail. It associates with the signaling lymphocyte-activation molecule, thereby acting as an inhibitor of this transmembrane protein by blocking the recruitment of the SH2-domain-containing signal-transduction molecule SHP-2 to its docking site. This protein can also bind to other related surface molecules that are expressed on activated T, B and NK cells, thereby modifying signal transduction pathways in these cells. Mutations in this gene cause lymphoproliferative syndrome X-linked type 1 or Duncan disease, a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus, with symptoms including severe mononucleosis and malignant lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SH2D1A: Inhibitor of the SLAM self-association. Acts by blocking recruitment of the SH2-domain-containing signal-transduction molecule SHP-2 to a docking site in the SLAM cytoplasmic region. Mediates interaction between FYN and SLAMF1. May also regulate the activity of the neurotrophin receptors NTRK1, NTRK2 and NTRK3. Interacts with NTRK1, NTRK2 and NTRK3. Interacts with CD84, CD244, LY9, SLAMF1 and FYN. Expressed at a high level in thymus and lung, with a lower level of expression in spleen and liver. Expressed in peripheral blood leukocytes, including T lymphocytes. Tends to be expressed at lower levels in peripheral blood leukocytes in patients with rheumatoid arthritis. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; Adaptor/scaffold

Chromosomal Location of Human Ortholog: Xq25

Cellular Component: cytoplasm; cytosol

Molecular Function: protein binding

Biological Process: cell-cell signaling; regulation of immune response

Disease: Lymphoproliferative Syndrome, X-linked, 1

Research Articles on SH2D1A

Similar Products

Product Notes

The SH2D1A sh2d1a (Catalog #AAA1267929) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgcag tggctgtgta tcatggcaaa atcagcaggg aaaccggcga gaagctcctg cttgccactg ggctggatgg cagctatttg ctgagggaca gcgagagcgt gccaggcgtg tactgcctat gtgtgctgta tcacggttac atttatacat accgagtgtc ccagacagaa acaggttctt ggagtgctga gacagcacct ggggtacata aaagatattt ccggaaaata aaaaatctca tttcagcatt tcagaagcca gatcaaggca ttgtaatacc tctgcagtat ccagttgaga agaagtcctc agctagaagt acacaaggta ctacagggat aagagaagat cctgatgtct gcctgaaagc cccatga. It is sometimes possible for the material contained within the vial of "SH2D1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.