Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERTAD1 cdna clone

SERTAD1 cDNA Clone

Gene Names
SERTAD1; SEI1; TRIP-Br1
Synonyms
SERTAD1; SERTAD1 cDNA Clone; SERTAD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgagcaagggtctgaagcggaaacgggaggaggaggaggagaaggaacctctggcagtcgactcctggtggctagatcctggccacacagcggtggcacaggcacccccggccgtggcctctagctccctctttgacctctcagtgctcaagctccaccacagcctgcagcagagtgagccggacctgcggcacctggtgctggtcgtgaacactctgcggcgcatccaggcgtccatggcacccgcggctgccctgccacctgtgcctagcccacctgcagcccccagtgtggctgacaacttactggcaagctcggacgctgccctttcagcctccatggccagcctcctggaggacctcagccacattgagggcctgagtcaggctccccaacccttggcagacgaggggccaccaggccgtagcatcgggggagcagcgcccagcctgggtgccttggacctgctgggcccagccactggctgtctactggacgatgggcttgagggcctgtttgaggatattgacacctctatgtatgacaatgaactttgggcaccagcctctgagggcctcaaaccaggccctgaggatgggccgggcaaggaggaagctccggagctggacgaggccgaattggactacctcatggatgtgctggtgggcacacaggcactggagcgaccgccggggccagggcgctga
Sequence Length
711
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,704 Da
NCBI Official Full Name
Homo sapiens SERTA domain containing 1, mRNA
NCBI Official Synonym Full Names
SERTA domain containing 1
NCBI Official Symbol
SERTAD1
NCBI Official Synonym Symbols
SEI1; TRIP-Br1
NCBI Protein Information
SERTA domain-containing protein 1
UniProt Protein Name
SERTA domain-containing protein 1
UniProt Gene Name
SERTAD1
UniProt Synonym Gene Names
SEI1; SEI-1; TRIP-Br1
UniProt Entry Name
SRTD1_HUMAN

Uniprot Description

SERTAD1: Acts at E2F-responsive promoters to integrate signals provided by PHD- and/or bromodomain-containing transcription factors. Stimulates E2F-1/DP-1 transcriptional activity. Renders the activity of cyclin D1/CDK4 resistant to the inhibitory effects of p16(INK4a).

Protein type: Cell cycle regulation; Transcription regulation

Chromosomal Location of Human Ortholog: 19q13.1-q13.2

Molecular Function: protein binding

Biological Process: positive regulation of cell proliferation; regulation of cyclin-dependent protein kinase activity

Research Articles on SERTAD1

Similar Products

Product Notes

The SERTAD1 sertad1 (Catalog #AAA1273935) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgagca agggtctgaa gcggaaacgg gaggaggagg aggagaagga acctctggca gtcgactcct ggtggctaga tcctggccac acagcggtgg cacaggcacc cccggccgtg gcctctagct ccctctttga cctctcagtg ctcaagctcc accacagcct gcagcagagt gagccggacc tgcggcacct ggtgctggtc gtgaacactc tgcggcgcat ccaggcgtcc atggcacccg cggctgccct gccacctgtg cctagcccac ctgcagcccc cagtgtggct gacaacttac tggcaagctc ggacgctgcc ctttcagcct ccatggccag cctcctggag gacctcagcc acattgaggg cctgagtcag gctccccaac ccttggcaga cgaggggcca ccaggccgta gcatcggggg agcagcgccc agcctgggtg ccttggacct gctgggccca gccactggct gtctactgga cgatgggctt gagggcctgt ttgaggatat tgacacctct atgtatgaca atgaactttg ggcaccagcc tctgagggcc tcaaaccagg ccctgaggat gggccgggca aggaggaagc tccggagctg gacgaggccg aattggacta cctcatggat gtgctggtgg gcacacaggc actggagcga ccgccggggc cagggcgctg a. It is sometimes possible for the material contained within the vial of "SERTAD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.