Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEMA4G cdna clone

SEMA4G cDNA Clone

Synonyms
SEMA4G; SEMA4G cDNA Clone; SEMA4G cdna clone
Ordering
For Research Use Only!
Sequence
atgggctcaatgtcaccaccctctgcatggccctgtgtgctggatggtcctgaaaccagacaagacctctgccagccacctaagccctgcgtacattcacatgcacacatggaagaatgtttatcggctgggctgcagtgcccccaccctcaccttctcctggtgcattcttgtttcatccctgcttctggacttggggtaccctcccaattgccacatcctatctggtcctcttccccagccccatgtggtgacctctttgtcaagagcttgggaacgggccagcctggggaggtaagactgcatcactcccctcctctcccttcctgtgtggcccttgtgaatcagcctccccactctccttggtcattctcaagagtatga
Sequence Length
384
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,577 Da
NCBI Official Full Name
Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G, mRNA
NCBI Official Synonym Full Names
semaphorin 4G
NCBI Official Symbol
SEMA4G
NCBI Protein Information
semaphorin-4G
UniProt Protein Name
Semaphorin-4G
Protein Family
UniProt Gene Name
SEMA4G
UniProt Synonym Gene Names
KIAA1619
UniProt Entry Name
SEM4G_HUMAN

NCBI Description

Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

Uniprot Description

SEMA4G: a single-pass type I membrane protein that may play a role in axon guidance.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 10q24.31

Cellular Component: extracellular space

Molecular Function: chemorepellent activity; protein binding; semaphorin receptor binding

Biological Process: negative chemotaxis; negative regulation of axon extension involved in axon guidance; neural crest cell migration; positive regulation of cell migration

Research Articles on SEMA4G

Similar Products

Product Notes

The SEMA4G sema4g (Catalog #AAA1276959) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctcaa tgtcaccacc ctctgcatgg ccctgtgtgc tggatggtcc tgaaaccaga caagacctct gccagccacc taagccctgc gtacattcac atgcacacat ggaagaatgt ttatcggctg ggctgcagtg cccccaccct caccttctcc tggtgcattc ttgtttcatc cctgcttctg gacttggggt accctcccaa ttgccacatc ctatctggtc ctcttcccca gccccatgtg gtgacctctt tgtcaagagc ttgggaacgg gccagcctgg ggaggtaaga ctgcatcact cccctcctct cccttcctgt gtggcccttg tgaatcagcc tccccactct ccttggtcat tctcaagagt atga. It is sometimes possible for the material contained within the vial of "SEMA4G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.