Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC61G cdna clone

SEC61G cDNA Clone

Gene Names
SEC61G; SSS1
Synonyms
SEC61G; SEC61G cDNA Clone; SEC61G cdna clone
Ordering
For Research Use Only!
Sequence
atggatcaggtaatgcagtttgttgagccaagtcggcagtttgtaaaggactccattcggctggttaaaagatgcactaaacctgatagaaaagaattccagaagattgccatggcaacagcaataggatttgctataatgggattcattggcttctttgtgaaattgatccatattcctattaataacatcattgttggtggctga
Sequence Length
207
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,741 Da
NCBI Official Full Name
Homo sapiens Sec61 gamma subunit, mRNA
NCBI Official Synonym Full Names
Sec61 translocon gamma subunit
NCBI Official Symbol
SEC61G
NCBI Official Synonym Symbols
SSS1
NCBI Protein Information
protein transport protein Sec61 subunit gamma
UniProt Protein Name
Protein transport protein Sec61 subunit gamma
Protein Family
UniProt Gene Name
SEC61G
UniProt Entry Name
SC61G_HUMAN

NCBI Description

The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the gamma-subunit protein. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

SEC61G: Necessary for protein translocation in the endoplasmic reticulum. Belongs to the SecE/SEC61-gamma family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 7p11.2

Cellular Component: cytosol; endoplasmic reticulum membrane; membrane

Molecular Function: protein binding; protein transporter activity

Biological Process: protein targeting to ER

Research Articles on SEC61G

Similar Products

Product Notes

The SEC61G sec61g (Catalog #AAA1276279) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcagg taatgcagtt tgttgagcca agtcggcagt ttgtaaagga ctccattcgg ctggttaaaa gatgcactaa acctgataga aaagaattcc agaagattgc catggcaaca gcaataggat ttgctataat gggattcatt ggcttctttg tgaaattgat ccatattcct attaataaca tcattgttgg tggctga. It is sometimes possible for the material contained within the vial of "SEC61G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.