Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCN3B cdna clone

SCN3B cDNA Clone

Gene Names
SCN3B; SCNB3; ATFB16; BRGDA7; HSA243396
Synonyms
SCN3B; SCN3B cDNA Clone; SCN3B cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgccttcaatagattgtttcccctggcttctctcgtgcttatctactgggtcagtgtctgcttccctgtgtgtgtggaagtgccctcggagacggaggccgtgcagggcaaccccatgaagctgcgctgcatctcctgcatgaagagagaggaggtggaggccaccacggtggtggaatggttctacaggcccgagggcggtaaagatttccttatttacgagtatcggaatggccaccaggaggtggagagcccctttcaggggcgcctgcagtggaatggcagcaaggacctgcaggacgtgtccatcactgtgctcaacgtcactctgaacgactctggcctctacacctgcaatgtgtcccgggagtttgagtttgaggcgcatcggccctttgtgaagacgacgcggctgatccccctaagagtcaccgaggaggctggagaggacttcacctctgtggtctcagaaatcatgatgtacatccttctggtcttcctcaccttgtggctgctcatcgagatgatatattgctacagaaaggtctcaaaagccgaagaggcagcccaagaaaacgcgtctgactaccttgccatcccatctgagaacaaggagaactctgcggtaccagtggaggaatag
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,702 Da
NCBI Official Full Name
Homo sapiens sodium channel, voltage-gated, type III, beta, mRNA
NCBI Official Synonym Full Names
sodium voltage-gated channel beta subunit 3
NCBI Official Symbol
SCN3B
NCBI Official Synonym Symbols
SCNB3; ATFB16; BRGDA7; HSA243396
NCBI Protein Information
sodium channel subunit beta-3
UniProt Protein Name
Sodium channel subunit beta-3
Protein Family
UniProt Gene Name
SCN3B
UniProt Synonym Gene Names
KIAA1158
UniProt Entry Name
SCN3B_HUMAN

NCBI Description

Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

SCN3B: Modulates channel gating kinetics. Causes unique persistent sodium currents. Inactivates the sodium channel opening more slowly than the subunit beta-1. Its association with neurofascin may target the sodium channels to the nodes of Ranvier of developing axons and retain these channels at the nodes in mature myelinated axons. Defects in SCN3B are the cause of Brugada syndrome type 7 (BRGDA7). A tachyarrhythmia characterized by right bundle branch block and ST segment elevation on an electrocardiogram (ECG). It can cause the ventricles to beat so fast that the blood is prevented from circulating efficiently in the body. When this situation occurs (called ventricular fibrillation), the individual will faint and may die in a few minutes if the heart is not reset. Belongs to the sodium channel auxiliary subunit SCN3B (TC 8.A.17) family.

Protein type: Membrane protein, integral; Channel, sodium

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: plasma membrane; voltage-gated sodium channel complex; Z disc

Molecular Function: sodium channel regulator activity

Biological Process: cardiac muscle contraction; membrane depolarization; positive regulation of heart rate

Disease: Brugada Syndrome 7

Research Articles on SCN3B

Similar Products

Product Notes

The SCN3B scn3b (Catalog #AAA1274268) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgcct tcaatagatt gtttcccctg gcttctctcg tgcttatcta ctgggtcagt gtctgcttcc ctgtgtgtgt ggaagtgccc tcggagacgg aggccgtgca gggcaacccc atgaagctgc gctgcatctc ctgcatgaag agagaggagg tggaggccac cacggtggtg gaatggttct acaggcccga gggcggtaaa gatttcctta tttacgagta tcggaatggc caccaggagg tggagagccc ctttcagggg cgcctgcagt ggaatggcag caaggacctg caggacgtgt ccatcactgt gctcaacgtc actctgaacg actctggcct ctacacctgc aatgtgtccc gggagtttga gtttgaggcg catcggccct ttgtgaagac gacgcggctg atccccctaa gagtcaccga ggaggctgga gaggacttca cctctgtggt ctcagaaatc atgatgtaca tccttctggt cttcctcacc ttgtggctgc tcatcgagat gatatattgc tacagaaagg tctcaaaagc cgaagaggca gcccaagaaa acgcgtctga ctaccttgcc atcccatctg agaacaagga gaactctgcg gtaccagtgg aggaatag. It is sometimes possible for the material contained within the vial of "SCN3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.