Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPS6KB1 cdna clone

RPS6KB1 cDNA Clone

Gene Names
RPS6KB1; S6K; PS6K; S6K1; STK14A; p70-S6K; p70 S6KA; p70-alpha; S6K-beta-1; p70(S6K)-alpha
Synonyms
RPS6KB1; RPS6KB1 cDNA Clone; RPS6KB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggcgacgaaggaggcgggacggcttttacccagccccggacttccgagacagggaagctgaggacatggcaggagtgtttgacatagacctggaccagccagaggacgcgggctctgaggatgagctggaggaggggggtcagttaaatgaaagcatggaccatgggggagttggaccatatgaacttggcatggaacattgtgagaaatttgaaatctcagaaactagtgtgaacagagggccagaaaaaatcagaccagaatgttttgagctacttcgggtacttggtaaagggggctatggaaaggtttttcaagtacgaaaagtaacaggagcaaatactgggaaaatatttgccatgaaggtgcttaaaaaggcaatgatagtaagaaatgctaaagatacagctcatacaaaagcagaacggaatattctggaggaagtaaagcatcccttcatcgtggatttaatttatgcctttcagactggtggaaaactctacctcatccttgagtatctcagtggaggagaactatttatgcagttagaaagagagggaatatttatggaagacactgcctgcttttacttggcagaaatctccatggctttggggcatttacatcaaaaggggatcatctacagagacctgaagccggagaatatcatgcttaatcaccaaggtcatgtgaaactaacagactttggactatgcaaagaatctattcatgatggaacagtcacacacacattttgtggaacaatagaatacatggcccctgaaatcttgatgagaagtggccacaatcgtgctgtggattggtggagtttgggagcattaatgtatgacatgctgactggagcacccccattcactggggagaatagaaagaaaacaattgacaaaatcctcaaatgtaaactcaatttgcctccctacctcacacaagaagccagagatctgcttaaaaagctgctgaaaagaaatgctgcttctcgtctgggagctggtcctggggacgctggagaagttcaagctcatccattctttagacacattaactgggaagaacttctggctcgaaaggtggagcccccctttaaacctctgttgcaatctgaagaggatgtaagtcagtttgattccaagtttacacgtcagacacctgtcgacagcccagatgactcaactctcagtgaaagtgccaatcaggtctttctgggttttacatatgtggctccatctgtacttgaaagtgtgaaagaaaagttttcctttgaaccaaaaatccgatcacctcgaagatttattggcagcccacgaacacctgtcagtactgctatgtgctaa
Sequence Length
1356
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,016 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1, mRNA
NCBI Official Synonym Full Names
ribosomal protein S6 kinase B1
NCBI Official Symbol
RPS6KB1
NCBI Official Synonym Symbols
S6K; PS6K; S6K1; STK14A; p70-S6K; p70 S6KA; p70-alpha; S6K-beta-1; p70(S6K)-alpha
NCBI Protein Information
ribosomal protein S6 kinase beta-1
UniProt Protein Name
Ribosomal protein S6 kinase beta-1
UniProt Gene Name
RPS6KB1
UniProt Synonym Gene Names
STK14A; S6K-beta-1; S6K1; P70S6K1; p70-S6K 1; p70 S6 kinase alpha; p70 S6K-alpha; p70 S6KA
UniProt Entry Name
KS6B1_HUMAN

NCBI Description

This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]

Uniprot Description

p70S6K: an AGC kinase of the RSK family that is required for cell growth and G1 cell cycle progression. Is phosphorylated and activated by mTOR in mitogenic pathways downstream of phosphoinositide 3 kinase (PI3K). Phosphorylates the S6 protein of the 40S ribosomal subunit and is involved in translational control of 5' oligopyrimidine tract mRNAs. Activity is controlled by multiple phosphorylation events located within the catalytic, linker and pseudosubstrate domains. Mouse knockout shows symptoms of insulin resistance, and increased insulin senstivity, resulting in protection against diet-induced obesity. Protein expression and activation upregulated in colon adenocarcinoma cell lines. Increased expression in breast cancer correlated with poor survival. Selectively amplified and overexpressed within the 17q23 breast cancer amplicon. Two isoforms produced by alternative initiation have been reported.

Protein type: Kinase, protein; Translation; Protein kinase, Ser/Thr (non-receptor); Protein kinase, AGC; EC 2.7.11.1; AGC group; RSK family; p70 subfamily

Chromosomal Location of Human Ortholog: 17q23.1

Cellular Component: cytosol; mitochondrion; nucleoplasm

Molecular Function: kinase activity; protein binding; protein kinase activity; protein serine/threonine/tyrosine kinase activity; ribosomal protein S6 kinase activity

Biological Process: G1/S transition of mitotic cell cycle; negative regulation of apoptosis; negative regulation of insulin receptor signaling pathway; phosphoinositide-mediated signaling; positive regulation of mitotic cell cycle; positive regulation of translation; positive regulation of translational initiation; signal transduction; TOR signaling pathway

Research Articles on RPS6KB1

Similar Products

Product Notes

The RPS6KB1 rps6kb1 (Catalog #AAA1269434) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggcgac gaaggaggcg ggacggcttt tacccagccc cggacttccg agacagggaa gctgaggaca tggcaggagt gtttgacata gacctggacc agccagagga cgcgggctct gaggatgagc tggaggaggg gggtcagtta aatgaaagca tggaccatgg gggagttgga ccatatgaac ttggcatgga acattgtgag aaatttgaaa tctcagaaac tagtgtgaac agagggccag aaaaaatcag accagaatgt tttgagctac ttcgggtact tggtaaaggg ggctatggaa aggtttttca agtacgaaaa gtaacaggag caaatactgg gaaaatattt gccatgaagg tgcttaaaaa ggcaatgata gtaagaaatg ctaaagatac agctcataca aaagcagaac ggaatattct ggaggaagta aagcatccct tcatcgtgga tttaatttat gcctttcaga ctggtggaaa actctacctc atccttgagt atctcagtgg aggagaacta tttatgcagt tagaaagaga gggaatattt atggaagaca ctgcctgctt ttacttggca gaaatctcca tggctttggg gcatttacat caaaagggga tcatctacag agacctgaag ccggagaata tcatgcttaa tcaccaaggt catgtgaaac taacagactt tggactatgc aaagaatcta ttcatgatgg aacagtcaca cacacatttt gtggaacaat agaatacatg gcccctgaaa tcttgatgag aagtggccac aatcgtgctg tggattggtg gagtttggga gcattaatgt atgacatgct gactggagca cccccattca ctggggagaa tagaaagaaa acaattgaca aaatcctcaa atgtaaactc aatttgcctc cctacctcac acaagaagcc agagatctgc ttaaaaagct gctgaaaaga aatgctgctt ctcgtctggg agctggtcct ggggacgctg gagaagttca agctcatcca ttctttagac acattaactg ggaagaactt ctggctcgaa aggtggagcc cccctttaaa cctctgttgc aatctgaaga ggatgtaagt cagtttgatt ccaagtttac acgtcagaca cctgtcgaca gcccagatga ctcaactctc agtgaaagtg ccaatcaggt ctttctgggt tttacatatg tggctccatc tgtacttgaa agtgtgaaag aaaagttttc ctttgaacca aaaatccgat cacctcgaag atttattggc agcccacgaa cacctgtcag tactgctatg tgctaa. It is sometimes possible for the material contained within the vial of "RPS6KB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.