Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPP21 cdna clone

RPP21 cDNA Clone

Gene Names
RPP21; CAT60; C6orf135
Synonyms
RPP21; RPP21 cDNA Clone; RPP21 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggggccggtgaaggaccgcgaggccttccagaggctcaacttcctgtaccaggccgcccattgtgtccttgcccaggaccccgagaaccaggcgctggcgaggttttactgctacactgagaggaccattgcgaagcggctcgtcttgcggcgggatccctcggtgaagaggactctctgtcgaggctgctcttccctcctcgtcccgggcctcacctgcacccaccgccagagacgctgcaggggacagcgctggaccgtacagacctgcctaacatgccagcgcagccaacgcttcctcaatgatcccgggcatttactctggggagacaggcctgaggcccagctcgggagccaagcagattccaaaccactacaacccttgccaaacacagcccactccatttcagaccgccttcctgaggagaaaatgcagactcagggttccagtaaccagtga
Sequence Length
465
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,366 Da
NCBI Official Full Name
Homo sapiens ribonuclease P/MRP 21kDa subunit, mRNA
NCBI Official Synonym Full Names
ribonuclease P/MRP subunit p21
NCBI Official Symbol
RPP21
NCBI Official Synonym Symbols
CAT60; C6orf135
NCBI Protein Information
ribonuclease P protein subunit p21
UniProt Protein Name
Ribonuclease P protein subunit p21
Protein Family
UniProt Gene Name
RPP21
UniProt Synonym Gene Names
C6orf135; CAT60; RNaseP protein p21
UniProt Entry Name
RPP21_HUMAN

NCBI Description

RPP21 is a protein subunit of nuclear ribonuclease P, which processes the 5-prime leader sequence of precursor tRNAs (Jarrous et al., 2001 [PubMed 11497433]).[supplied by OMIM, Jan 2009]

Uniprot Description

RPP21: Component of ribonuclease P, a protein complex that generates mature tRNA molecules by cleaving their 5'-ends. Belongs to the eukaryotic/archaeal RNase P protein component 4 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; Ribonuclease; EC 3.1.26.5

Chromosomal Location of Human Ortholog: 6p22.1

Cellular Component: nucleolar ribonuclease P complex; nucleoplasm

Molecular Function: ribonuclease P activity

Biological Process: response to drug; rRNA processing; tRNA 5'-leader removal; tRNA processing

Research Articles on RPP21

Similar Products

Product Notes

The RPP21 rpp21 (Catalog #AAA1276878) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggggc cggtgaagga ccgcgaggcc ttccagaggc tcaacttcct gtaccaggcc gcccattgtg tccttgccca ggaccccgag aaccaggcgc tggcgaggtt ttactgctac actgagagga ccattgcgaa gcggctcgtc ttgcggcggg atccctcggt gaagaggact ctctgtcgag gctgctcttc cctcctcgtc ccgggcctca cctgcaccca ccgccagaga cgctgcaggg gacagcgctg gaccgtacag acctgcctaa catgccagcg cagccaacgc ttcctcaatg atcccgggca tttactctgg ggagacaggc ctgaggccca gctcgggagc caagcagatt ccaaaccact acaacccttg ccaaacacag cccactccat ttcagaccgc cttcctgagg agaaaatgca gactcagggt tccagtaacc agtga. It is sometimes possible for the material contained within the vial of "RPP21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.