Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF6 cdna clone

RNF6 cDNA Clone

Synonyms
RNF6; RNF6 cDNA Clone; RNF6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatcagtctagatcgagatcagatggtggcagtgaagaaaccttacctcaagaccataatcatcatgaaaatgagagaagatggcagcaagagcgtctccacagagaagaggcctattatcagtttattaatgaactcaatgatgaagattatcggcttatgagagaccataatcttttaggcacccctggagaaataacatcagaagaactgcaacagcggttagatggcgtcaaggaacaactagcatctcagcctgacttgagagatggaacgaattacagagactcagaagtccctagagaaagttcacatgaagattctcttctagaatggttgaacacctttcggcgcacaggaaatgcaactcgaagtggacaaaatgggaaccaaacttggagagctgtgagtcgaacaaacccgaacaatggagagtttcggtttagtttggaaatccacgtaaatcatgaaaatagaggatttgaaattcatggagaagattatacagacattccactttcagatagtaacagagatcatactgcaaataggcaacaaaggtcaactagtcctgtggctaggcgaacaagaagccaaacctcagtgaatttcaatggtagtagttccaacattccaaggactaggcttgcttcaagggggcaaaatccagctgaaggatctttctcaacattgggaaggttaagaaatggaattgggggagcagctggcattcctcgagctaacgcttcacgcactaatttcagtagtcacacaaaccaatcaggtggtagtgaactcaggcaaagggaggggcaacggtttggagcagcacatgtttgggaaaatggggctagaagtaatgttacagtgaggaatacaaaccaaagattagagccaataagattacgatctacttccaatagtcgaagccgttcaccaattcagagacagagtggcactgtttatcataattcccaaagggaaagtagaccagtacagcaaaccactagaagatctgttaggaggagaggtagaactcgagtctttttagagcaagatagagaacgagaacgcagaggtactgcatataccccattctctaattcaaggcttgtgtcaagaataacagtagaagaaggagaagaatccagcagatcctcaactgctgtacgacgacatccaacaatcacactggaccttcaagtgagaaggatccgtcctggagaaaatagagatcgggatagtattgcaaatagaactcgatccagagtagggctagcagaaaatacagtcactattgaaagcaatagtgggggctttcgccgaaccatttctcgtttagagcggtcaggtattcgaacctatgttagtaccataacagttcctcttcgtaggatttctgagaatgagcttgttgagccatcatcagtggctcttcggtcaattttaaggcagatcatgactgggtttggagaactgagttctctaatggaggccgattctgagtcagaacttcaaagaaatggccagcatttaccagacatgcactcagaactgagtaacttaggtacagataacaacaggagccagcacagggaaggttcctctcaagacaggcaggcccaaggagacagcactgaaatgcatggtgaaaacgagaccacccagcctcatactcgaaacagtgacagtaggggtggcaggcagttgcgaaatccaaacaatttagttgaaactggaacactacccattcttcgccttgctcacttttttttactaaatgaaagtgatgatgatgatcgaatacgtggtttaaccaaagagcagattgacaatctttccaccaggcactatgagcataacagtattgatagtgaactaggtaaaatctgtagtgtttgtattagtgactatgtaactggaaacaagctcaggcaattaccttgcatgcatgaatttcacattcattgtattgaccgatggctctcagagaattgcacttgtccgatctgtcggcagcctgttttagggtctaacatagcaaacaatgggtaa
Sequence Length
2058
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,680 Da
NCBI Official Full Name
Homo sapiens ring finger protein (C3H2C3 type) 6, mRNA
NCBI Official Synonym Full Names
ring finger protein 6
NCBI Official Symbol
RNF6
NCBI Protein Information
E3 ubiquitin-protein ligase RNF6
UniProt Protein Name
E3 ubiquitin-protein ligase RNF6
UniProt Gene Name
RNF6
UniProt Synonym Gene Names
SPG2
UniProt Entry Name
RNF6_HUMAN

NCBI Description

The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed. [provided by RefSeq, Jul 2008]

Uniprot Description

RNF6: E3 ubiquitin-protein ligase mediating 'Lys-48'-linked polyubiquitination of LIMK1 and its subsequent targeting to the proteasome for degradation. Negatively regulates axonal outgrowth through regulation of the LIMK1 turnover. Mediates 'Lys-6' and 'Lys-27'-linked polyubiquitination of AR/androgen receptor thereby modulating its transcriptional activity. May also bind DNA and function as a transcriptional regulator. Defects in RNF6 may be a cause of esophageal cancer (ESCR). A malignancy of the esophagus. The most common types are esophageal squamous cell carcinoma and adenocarcinoma. Cancer of the esophagus remains a devastating disease because it is usually not detected until it has progressed to an advanced incurable stage. Belongs to the RNF12 family.

Protein type: Ligase; Ubiquitin conjugating system; Ubiquitin ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 13q12.2

Cellular Component: axon; cytoplasm; intracellular membrane-bound organelle; nuclear membrane; nucleoplasm; nucleus

Molecular Function: androgen receptor binding; protein binding; ubiquitin-protein ligase activity

Biological Process: negative regulation of axon extension; positive regulation of transcription, DNA-dependent; proteasomal ubiquitin-dependent protein catabolic process; regulation of transcription, DNA-dependent; ubiquitin-dependent protein catabolic process

Disease: Esophageal Cancer

Research Articles on RNF6

Similar Products

Product Notes

The RNF6 rnf6 (Catalog #AAA1278475) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcagt ctagatcgag atcagatggt ggcagtgaag aaaccttacc tcaagaccat aatcatcatg aaaatgagag aagatggcag caagagcgtc tccacagaga agaggcctat tatcagttta ttaatgaact caatgatgaa gattatcggc ttatgagaga ccataatctt ttaggcaccc ctggagaaat aacatcagaa gaactgcaac agcggttaga tggcgtcaag gaacaactag catctcagcc tgacttgaga gatggaacga attacagaga ctcagaagtc cctagagaaa gttcacatga agattctctt ctagaatggt tgaacacctt tcggcgcaca ggaaatgcaa ctcgaagtgg acaaaatggg aaccaaactt ggagagctgt gagtcgaaca aacccgaaca atggagagtt tcggtttagt ttggaaatcc acgtaaatca tgaaaataga ggatttgaaa ttcatggaga agattataca gacattccac tttcagatag taacagagat catactgcaa ataggcaaca aaggtcaact agtcctgtgg ctaggcgaac aagaagccaa acctcagtga atttcaatgg tagtagttcc aacattccaa ggactaggct tgcttcaagg gggcaaaatc cagctgaagg atctttctca acattgggaa ggttaagaaa tggaattggg ggagcagctg gcattcctcg agctaacgct tcacgcacta atttcagtag tcacacaaac caatcaggtg gtagtgaact caggcaaagg gaggggcaac ggtttggagc agcacatgtt tgggaaaatg gggctagaag taatgttaca gtgaggaata caaaccaaag attagagcca ataagattac gatctacttc caatagtcga agccgttcac caattcagag acagagtggc actgtttatc ataattccca aagggaaagt agaccagtac agcaaaccac tagaagatct gttaggagga gaggtagaac tcgagtcttt ttagagcaag atagagaacg agaacgcaga ggtactgcat ataccccatt ctctaattca aggcttgtgt caagaataac agtagaagaa ggagaagaat ccagcagatc ctcaactgct gtacgacgac atccaacaat cacactggac cttcaagtga gaaggatccg tcctggagaa aatagagatc gggatagtat tgcaaataga actcgatcca gagtagggct agcagaaaat acagtcacta ttgaaagcaa tagtgggggc tttcgccgaa ccatttctcg tttagagcgg tcaggtattc gaacctatgt tagtaccata acagttcctc ttcgtaggat ttctgagaat gagcttgttg agccatcatc agtggctctt cggtcaattt taaggcagat catgactggg tttggagaac tgagttctct aatggaggcc gattctgagt cagaacttca aagaaatggc cagcatttac cagacatgca ctcagaactg agtaacttag gtacagataa caacaggagc cagcacaggg aaggttcctc tcaagacagg caggcccaag gagacagcac tgaaatgcat ggtgaaaacg agaccaccca gcctcatact cgaaacagtg acagtagggg tggcaggcag ttgcgaaatc caaacaattt agttgaaact ggaacactac ccattcttcg ccttgctcac ttttttttac taaatgaaag tgatgatgat gatcgaatac gtggtttaac caaagagcag attgacaatc tttccaccag gcactatgag cataacagta ttgatagtga actaggtaaa atctgtagtg tttgtattag tgactatgta actggaaaca agctcaggca attaccttgc atgcatgaat ttcacattca ttgtattgac cgatggctct cagagaattg cacttgtccg atctgtcggc agcctgtttt agggtctaac atagcaaaca atgggtaa. It is sometimes possible for the material contained within the vial of "RNF6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.