Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF10 cdna clone

RNF10 cDNA Clone

Gene Names
RNF10; RIE2
Synonyms
RNF10; RNF10 cDNA Clone; RNF10 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgctgagctcccccaacgccgccgccaccgcctccgacatggacaagaacagcggctccaacagctcctccgcctcttcgggcagcagcaaagggcaacagccgccccgctccgcctcggcggggccagccggcgagtctaaacccaagagcgatggaaagaactccagtggatccaagcgttataatcgcaaacgtgaactttcctaccccaaaaatgaaagttttaacaaccagtcccgtcgctccagttcacagaaaagcaagacttttaacaagatgcctcctcaaaggggcggcggcagcagcaaactctttagctcttcttttaatggtggaagacgagatgaggtagcagaggctcaacgggcagagtttagccctgcccagttctctggtcctaagaagatcaacctgaaccacttgttgaatttcacttttgaaccccgtggccagacgggtcactttgaaggcagtggacatggtagctggggaaagaggaacaagtggggacataagccttttaacaaggaactctttttacaggccaactgccaatttgtggtgtctgaagaccaagactacacagctcattttgctgatcctgatacattagttaactgggactttgtggaacaagtgcgcatttgtagccatgaagtgccatcttgcccaatatgcctctatccacctactgcagccaagataacccgttgtggacacatcttctgctgggcatgcatcctgcactatctttcactgagtgagaagacgtggagtaaatgtcccatctgttacagttctgtgcataagaaggatctcaagagtgttgttgccacagagtcacatcagtatgttgttggtgataccattacgatgcagctgatgaagagggagaaaggggtgttggtggctttgcccaaatccaaatggatgaatgtagaccatcccattcatctaggagatgaacagcacagccagtactccaagttgctgctggcctctaaggagcaggtgctgcaccgggtagttctggaggagaaagtagcactagagcagcagctggcagaggagaagcacactcccgagtcctgctttattgaggcagctatccaggagctcaagactcgggaagaggctctgtcgggattggccggaagcagaagggaggtcactggtgttgtggctgctctggaacaactggtgctgatggctcccttggcgaaggagtctgtttttcaacccaggaagggtgtgctggagtatctgtctgccttcgatgaagaaaccacggaagtttgttctctggacactccttctagacctcttgctctccctctggtagaagaggaggaagcagtgtctgaaccagagcctgaggggttgccagaggcctgtgatgacttggagttagcagatgacaatcttaaagaggggaccatttgcactgagtccagccagcaggaacccatcaccaagtcaggcttcacacgcctcagcagctctccttgttactacttttaccaagcggaagatggacagcatatgttcctgcaccctgtgaatgtgcgctgcctcgtgcgggagtacggcagcctggagaggagccccgagaagatctcagcaactgtggtggagattgctggctactccatgtctgaggatgttcgacagcgtcacagatatctctctcacttgccactcacctgtgagttcagcatctgtgaactggctttgcaacctcctgtggtctctaaggaaaccctagagatgttctcagatgacattgagaagaggaaacgtcagcgccaaaagaaggctcgggaggaacgccgccgagagcgcaggattgagatagaggagaacaagaaacagggcaagtacccagaagtccacattcccctcgagaatctacagcagtttcctgccttcaattcttatacctgctcctctgattctgctttgggtcccaccagcaccgagggccatggggccctctccatttctcctctcagcagaagtccaggttcccatgcagactttctgctgacccctctgtcacccactgccagtcagggcagtccctcattctgcgttgggagtctggaagaagactctcccttcccttcctttgcccagatgctgagggttggaaaagcaaaagcagatgtgtggcccaaaactgctccaaagaaagatgagaacagcttagttcctcctgcccctgtggacagcgacggggagagtgataattcagaccgtgttcctgtgcccagttttcaaaattccttcagccaagctattgaagcagccttcatgaaactggacacaccagctacttcagatcccctctctgaagagaaaggaggaaagaaaagaaaaaaacagaaacagaagctcctgttcagcacctcagtcgtccacaccaagtga
Sequence Length
2436
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,497 Da
NCBI Official Full Name
Homo sapiens ring finger protein 10, mRNA
NCBI Official Synonym Full Names
ring finger protein 10
NCBI Official Symbol
RNF10
NCBI Official Synonym Symbols
RIE2
NCBI Protein Information
RING finger protein 10
UniProt Protein Name
RING finger protein 10
Protein Family
UniProt Gene Name
RNF10
UniProt Synonym Gene Names
KIAA0262; RIE2
UniProt Entry Name
RNF10_HUMAN

NCBI Description

The protein encoded by this gene contains a ring finger motif, which is known to be involved in protein-protein interactions. The specific function of this protein has not yet been determined. EST data suggests the existence of multiple alternatively spliced transcript variants, however, their full length nature is not known. [provided by RefSeq, Jul 2008]

Uniprot Description

RNF10: Transcriptional factor involved in the regulation of MAG expression. Participates in the peripheral nerve development and Schawnn cell differentiation. Belongs to the RNF10 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: positive regulation of myelination; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein autoubiquitination

Research Articles on RNF10

Similar Products

Product Notes

The RNF10 rnf10 (Catalog #AAA1268403) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgctga gctcccccaa cgccgccgcc accgcctccg acatggacaa gaacagcggc tccaacagct cctccgcctc ttcgggcagc agcaaagggc aacagccgcc ccgctccgcc tcggcggggc cagccggcga gtctaaaccc aagagcgatg gaaagaactc cagtggatcc aagcgttata atcgcaaacg tgaactttcc taccccaaaa atgaaagttt taacaaccag tcccgtcgct ccagttcaca gaaaagcaag acttttaaca agatgcctcc tcaaaggggc ggcggcagca gcaaactctt tagctcttct tttaatggtg gaagacgaga tgaggtagca gaggctcaac gggcagagtt tagccctgcc cagttctctg gtcctaagaa gatcaacctg aaccacttgt tgaatttcac ttttgaaccc cgtggccaga cgggtcactt tgaaggcagt ggacatggta gctggggaaa gaggaacaag tggggacata agccttttaa caaggaactc tttttacagg ccaactgcca atttgtggtg tctgaagacc aagactacac agctcatttt gctgatcctg atacattagt taactgggac tttgtggaac aagtgcgcat ttgtagccat gaagtgccat cttgcccaat atgcctctat ccacctactg cagccaagat aacccgttgt ggacacatct tctgctgggc atgcatcctg cactatcttt cactgagtga gaagacgtgg agtaaatgtc ccatctgtta cagttctgtg cataagaagg atctcaagag tgttgttgcc acagagtcac atcagtatgt tgttggtgat accattacga tgcagctgat gaagagggag aaaggggtgt tggtggcttt gcccaaatcc aaatggatga atgtagacca tcccattcat ctaggagatg aacagcacag ccagtactcc aagttgctgc tggcctctaa ggagcaggtg ctgcaccggg tagttctgga ggagaaagta gcactagagc agcagctggc agaggagaag cacactcccg agtcctgctt tattgaggca gctatccagg agctcaagac tcgggaagag gctctgtcgg gattggccgg aagcagaagg gaggtcactg gtgttgtggc tgctctggaa caactggtgc tgatggctcc cttggcgaag gagtctgttt ttcaacccag gaagggtgtg ctggagtatc tgtctgcctt cgatgaagaa accacggaag tttgttctct ggacactcct tctagacctc ttgctctccc tctggtagaa gaggaggaag cagtgtctga accagagcct gaggggttgc cagaggcctg tgatgacttg gagttagcag atgacaatct taaagagggg accatttgca ctgagtccag ccagcaggaa cccatcacca agtcaggctt cacacgcctc agcagctctc cttgttacta cttttaccaa gcggaagatg gacagcatat gttcctgcac cctgtgaatg tgcgctgcct cgtgcgggag tacggcagcc tggagaggag ccccgagaag atctcagcaa ctgtggtgga gattgctggc tactccatgt ctgaggatgt tcgacagcgt cacagatatc tctctcactt gccactcacc tgtgagttca gcatctgtga actggctttg caacctcctg tggtctctaa ggaaacccta gagatgttct cagatgacat tgagaagagg aaacgtcagc gccaaaagaa ggctcgggag gaacgccgcc gagagcgcag gattgagata gaggagaaca agaaacaggg caagtaccca gaagtccaca ttcccctcga gaatctacag cagtttcctg ccttcaattc ttatacctgc tcctctgatt ctgctttggg tcccaccagc accgagggcc atggggccct ctccatttct cctctcagca gaagtccagg ttcccatgca gactttctgc tgacccctct gtcacccact gccagtcagg gcagtccctc attctgcgtt gggagtctgg aagaagactc tcccttccct tcctttgccc agatgctgag ggttggaaaa gcaaaagcag atgtgtggcc caaaactgct ccaaagaaag atgagaacag cttagttcct cctgcccctg tggacagcga cggggagagt gataattcag accgtgttcc tgtgcccagt tttcaaaatt ccttcagcca agctattgaa gcagccttca tgaaactgga cacaccagct acttcagatc ccctctctga agagaaagga ggaaagaaaa gaaaaaaaca gaaacagaag ctcctgttca gcacctcagt cgtccacacc aagtga. It is sometimes possible for the material contained within the vial of "RNF10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.