Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS2 cdna clone

RGS2 cDNA Clone

Gene Names
RGS2; G0S8
Synonyms
RGS2; RGS2 cDNA Clone; RGS2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaagtgctatgttcttggctgttcaacacgactgcagacccatggacaagagcgcaggcagtggccacaagagcgaggagaagcgagaaaagatgaaacggacccttttaaaagattggaagacccgtttgagctacttcttacaaaattcctctactcctgggaagcccaaaaccggcaaaaaaagcaaacagcaagctttcatcaagccttctcctgaggaagcacagctgtggtcagaagcatttgacgagctgctagccagcaaatatggtcttgctgcattcagggcttttttaaagtcggaattctgtgaagaaaatattgaattctggctggcctgtgaagacttcaaaaaaaccaaatcaccccaaaagctgtcctcaaaagcaaggaaaatatatactgacttcatagaaaaggaagctccaaaagagataaacatagattttcaaaccaaaactctgattgcccagaatatacaagaagctacaagtggctgctttacaactgcccagaaaagggtatacagcttgatggagaacaactcttatcctcgtttcttggagtcagaattctaccaggacttgtgtaaaaagccacaaatcaccacagagcctcatgctacatga
Sequence Length
636
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,780 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 2, 24kDa, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 2
NCBI Official Symbol
RGS2
NCBI Official Synonym Symbols
G0S8
NCBI Protein Information
regulator of G-protein signaling 2
UniProt Protein Name
Regulator of G-protein signaling 2
UniProt Gene Name
RGS2
UniProt Synonym Gene Names
G0S8; RGS2
UniProt Entry Name
RGS2_HUMAN

NCBI Description

Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 2 belongs to this family. The protein acts as a mediator of myeloid differentiation and may play a role in leukemogenesis. [provided by RefSeq, Aug 2009]

Uniprot Description

RGS2: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. May play a role in leukemogenesis. Plays a role in negative feedback control pathway for adenylyl cyclase signaling. Binds EIF2B5 and blocks its activity, thereby inhibiting the translation of mRNA into protein. 4 isoforms of the human protein are produced by alternative initiation.

Protein type: GAPs; GAPs, misc.; Nucleolus

Chromosomal Location of Human Ortholog: 1q31

Cellular Component: cytoplasm; cytosol; internal side of plasma membrane; nucleus; plasma membrane

Molecular Function: calmodulin binding; G-protein alpha-subunit binding; GTPase activator activity; protein binding

Biological Process: negative regulation of G-protein coupled receptor protein signaling pathway; negative regulation of MAP kinase activity; regulation of G-protein coupled receptor protein signaling pathway

Research Articles on RGS2

Similar Products

Product Notes

The RGS2 rgs2 (Catalog #AAA1277735) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaagtg ctatgttctt ggctgttcaa cacgactgca gacccatgga caagagcgca ggcagtggcc acaagagcga ggagaagcga gaaaagatga aacggaccct tttaaaagat tggaagaccc gtttgagcta cttcttacaa aattcctcta ctcctgggaa gcccaaaacc ggcaaaaaaa gcaaacagca agctttcatc aagccttctc ctgaggaagc acagctgtgg tcagaagcat ttgacgagct gctagccagc aaatatggtc ttgctgcatt cagggctttt ttaaagtcgg aattctgtga agaaaatatt gaattctggc tggcctgtga agacttcaaa aaaaccaaat caccccaaaa gctgtcctca aaagcaagga aaatatatac tgacttcata gaaaaggaag ctccaaaaga gataaacata gattttcaaa ccaaaactct gattgcccag aatatacaag aagctacaag tggctgcttt acaactgccc agaaaagggt atacagcttg atggagaaca actcttatcc tcgtttcttg gagtcagaat tctaccagga cttgtgtaaa aagccacaaa tcaccacaga gcctcatgct acatga. It is sometimes possible for the material contained within the vial of "RGS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.