Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RDBP cdna clone

RDBP cDNA Clone

Gene Names
NELFE; RD; RDP; RDBP; D6S45; NELF-E
Synonyms
RDBP; RDBP cDNA Clone; RDBP cdna clone
Ordering
For Research Use Only!
Sequence
atgttggtgataccccccggactgagcgaggaagaggaggctctgcagaagaaattcaacaagctcaagaaaaagaaaaaggcattgctggctctgaagaagcaaagtagcagcagcacaaccagccaaggtggtgtcaaacgctcactatcagagcagcctgtcatggacacagccacagcaacagagcaggcaaagcagctggtgaagtcaggagccatcagtgccatcaaggctgagaccaagaactcaggcttcaagcgttctcgaacccttgaggggaagttaaaggaccccgagaagggaccagtccccactttccagccgttccagaggagcatatctgctgatgatgacctgcaagagtcatccagacgtccccagaggaaatctctgtatgagagctttgtgtcttctagtgatcgacttcgagaactaggaccagatggagaagaggcagagggcccaggggctggtgatggtccccctcgaagctttgactggggctatgaagaacgcagtggtgcccactcctcagcctcccctccccgaagccgcagccgggaccgcagccatgagaggaaccgggacagagaccgagatcgggagcgggatcgagaccgggatcgagacagagacagagagcgggacagggatcgggatcgggatcgagatcgagaccgggaacgggacagggatcgggagcgggatcgagaccgagaccgagagggtcctttccgcaggtcggattcattccctgaacggcgagcccctaggaaagggaatactctctatgtatatggagaagacatgacacccacccttctccgtggggccttctctccttttggaaacatcattgacctctccatggacccacccagaaactgtgccttcgtcacctatgaaaagatggagtcagcagatcaggccgttgctgagctcaacgggacccaggtggagtctgtacagctcaaagtcaacatagcccgaaaacagcccatgctggatgccgctactggcaagtctgtctggggctccctcgctgtccagaacagccctaagggttgccaccgggacaagaggacccagattgtctacagtgatgacgtctacaaggaaaaccttgtggatggcttctag
Sequence Length
1143
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,216 Da
NCBI Official Full Name
Homo sapiens RD RNA binding protein, mRNA
NCBI Official Synonym Full Names
negative elongation factor complex member E
NCBI Official Symbol
NELFE
NCBI Official Synonym Symbols
RD; RDP; RDBP; D6S45; NELF-E
NCBI Protein Information
negative elongation factor E
UniProt Protein Name
Negative elongation factor E
UniProt Gene Name
NELFE
UniProt Synonym Gene Names
RD; RDBP; NELF-E
UniProt Entry Name
NELFE_HUMAN

NCBI Description

The protein encoded by this gene is part of a complex termed negative elongation factor (NELF) which represses RNA polymerase II transcript elongation. This protein bears similarity to nuclear RNA-binding proteins; however, it has not been demonstrated that this protein binds RNA. The protein contains a tract of alternating basic and acidic residues, largely arginine (R) and aspartic acid (D). The gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. [provided by RefSeq, Jul 2008]

Uniprot Description

RDBP: Essential component of the NELF complex, a complex that negatively regulates the elongation of transcription by RNA polymerase II. The NELF complex, which acts via an association with the DSIF complex and causes transcriptional pausing, is counteracted by the P-TEFb kinase complex. Belongs to the RRM NELF-E family.

Protein type: Transcription, coactivator/corepressor; Mitochondrial

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: nucleoplasm

Molecular Function: protein binding

Biological Process: positive regulation of viral transcription; RNA elongation from RNA polymerase II promoter; transcription from RNA polymerase II promoter

Research Articles on RDBP

Similar Products

Product Notes

The RDBP nelfe (Catalog #AAA1276909) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggtga taccccccgg actgagcgag gaagaggagg ctctgcagaa gaaattcaac aagctcaaga aaaagaaaaa ggcattgctg gctctgaaga agcaaagtag cagcagcaca accagccaag gtggtgtcaa acgctcacta tcagagcagc ctgtcatgga cacagccaca gcaacagagc aggcaaagca gctggtgaag tcaggagcca tcagtgccat caaggctgag accaagaact caggcttcaa gcgttctcga acccttgagg ggaagttaaa ggaccccgag aagggaccag tccccacttt ccagccgttc cagaggagca tatctgctga tgatgacctg caagagtcat ccagacgtcc ccagaggaaa tctctgtatg agagctttgt gtcttctagt gatcgacttc gagaactagg accagatgga gaagaggcag agggcccagg ggctggtgat ggtccccctc gaagctttga ctggggctat gaagaacgca gtggtgccca ctcctcagcc tcccctcccc gaagccgcag ccgggaccgc agccatgaga ggaaccggga cagagaccga gatcgggagc gggatcgaga ccgggatcga gacagagaca gagagcggga cagggatcgg gatcgggatc gagatcgaga ccgggaacgg gacagggatc gggagcggga tcgagaccga gaccgagagg gtcctttccg caggtcggat tcattccctg aacggcgagc ccctaggaaa gggaatactc tctatgtata tggagaagac atgacaccca cccttctccg tggggccttc tctccttttg gaaacatcat tgacctctcc atggacccac ccagaaactg tgccttcgtc acctatgaaa agatggagtc agcagatcag gccgttgctg agctcaacgg gacccaggtg gagtctgtac agctcaaagt caacatagcc cgaaaacagc ccatgctgga tgccgctact ggcaagtctg tctggggctc cctcgctgtc cagaacagcc ctaagggttg ccaccgggac aagaggaccc agattgtcta cagtgatgac gtctacaagg aaaaccttgt ggatggcttc tag. It is sometimes possible for the material contained within the vial of "RDBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.