Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBMS1 cdna clone

RBMS1 cDNA Clone

Gene Names
RBMS1; YC1; MSSP; SCR2; HCC-4; MSSP-1; MSSP-2; MSSP-3; C2orf12
Synonyms
RBMS1; RBMS1 cDNA Clone; RBMS1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcaaagtgtggaaacagcagatgtaccctcagtacgccacctactattacccccagtatctgcaagccaagcagtctctggtcccagcccaccccatggcccctcccagtcccagcaccaccagcagtaataacaacagtagcagcagtagcaactcaggatgggatcagctcagcaaaacgaacctctatatccgaggactgcctccccacaccaccgaccaggacctggtgaagctctgtcaaccatatgggaaaatagtctccacaaaggcaattttggataagacaacaaacaaatgcaaaggttatggttttgtcgactttgacagccctgcagcagctcaaaaagctgtgtctgccctgaaggccagtggggttcaagctcaaatggcaaagcaacaggaacaagatcctaccaacctctacatttctaatttgccactctccatggatgagcaagaactagaaaatatgctcaaaccatttggacaagttatttctacaaggatactacgtgattccagtggtacaagtcgtggtgttggctttgctaggatggaatcaacagaaaaatgtgaagctgttattggtcattttaatggaaaatttattaagacaccaccaggagtttctgcccccacagaacctttattgtgtaagtttgctgatggaggacagaaaaagagacagaacccaaacaaatacatccctaatggaagaccatggcatagagaaggagaggctggaatgacacttacttacgacccaactacagctgctatacagaacggattttatccttcaccatacagtattgctacaaaccgaatgatcactcaaacttctattacaccctatattgcatctcctgtatctgcctaccaggtgcaaagtccttcgtggatgcaacctcaaccatatattctacagcaccctggtgccgtgttaactccctcaatggagcacaccatgtcactacagcccgcatcaatgatcagccctctggcccagcagatgagtcatctgtcactaggcagcaccggaacatacatgcctgcaacgtcagctatgcaaggagcctacttgccacagtatgcacatatgcagacgacagcggttcctgttgaggaggcaagtggtcaacagcaggtggctgtcgagacgtctaatgaccattctccatatacctttcaacctaataagtaa
Sequence Length
1212
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
4,632 Da
NCBI Official Full Name
Homo sapiens RNA binding motif, single stranded interacting protein 1, mRNA
NCBI Official Synonym Full Names
RNA binding motif single stranded interacting protein 1
NCBI Official Symbol
RBMS1
NCBI Official Synonym Symbols
YC1; MSSP; SCR2; HCC-4; MSSP-1; MSSP-2; MSSP-3; C2orf12
NCBI Protein Information
RNA-binding motif, single-stranded-interacting protein 1
UniProt Protein Name
RNA-binding motif, single-stranded-interacting protein 1
UniProt Gene Name
RBMS1
UniProt Synonym Gene Names
C2orf12; MSSP; MSSP1; SCR2
UniProt Entry Name
RBMS1_HUMAN

NCBI Description

This gene encodes a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. Several transcript variants, resulting from alternative splicing and encoding different isoforms, have been described. A pseudogene for this locus is found on chromosome 12. [provided by RefSeq, Feb 2009]

Uniprot Description

RBMS1: Single-stranded DNA binding protein that interacts with the region upstream of the MYC gene. Binds specifically to the DNA sequence motif 5'-[AT]CT[AT][AT]T-3'. Probably has a role in DNA replication. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; DNA replication

Chromosomal Location of Human Ortholog: 2q24.2

Molecular Function: protein binding

Biological Process: RNA processing

Research Articles on RBMS1

Similar Products

Product Notes

The RBMS1 rbms1 (Catalog #AAA1278596) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcaaag tgtggaaaca gcagatgtac cctcagtacg ccacctacta ttacccccag tatctgcaag ccaagcagtc tctggtccca gcccacccca tggcccctcc cagtcccagc accaccagca gtaataacaa cagtagcagc agtagcaact caggatggga tcagctcagc aaaacgaacc tctatatccg aggactgcct ccccacacca ccgaccagga cctggtgaag ctctgtcaac catatgggaa aatagtctcc acaaaggcaa ttttggataa gacaacaaac aaatgcaaag gttatggttt tgtcgacttt gacagccctg cagcagctca aaaagctgtg tctgccctga aggccagtgg ggttcaagct caaatggcaa agcaacagga acaagatcct accaacctct acatttctaa tttgccactc tccatggatg agcaagaact agaaaatatg ctcaaaccat ttggacaagt tatttctaca aggatactac gtgattccag tggtacaagt cgtggtgttg gctttgctag gatggaatca acagaaaaat gtgaagctgt tattggtcat tttaatggaa aatttattaa gacaccacca ggagtttctg cccccacaga acctttattg tgtaagtttg ctgatggagg acagaaaaag agacagaacc caaacaaata catccctaat ggaagaccat ggcatagaga aggagaggct ggaatgacac ttacttacga cccaactaca gctgctatac agaacggatt ttatccttca ccatacagta ttgctacaaa ccgaatgatc actcaaactt ctattacacc ctatattgca tctcctgtat ctgcctacca ggtgcaaagt ccttcgtgga tgcaacctca accatatatt ctacagcacc ctggtgccgt gttaactccc tcaatggagc acaccatgtc actacagccc gcatcaatga tcagccctct ggcccagcag atgagtcatc tgtcactagg cagcaccgga acatacatgc ctgcaacgtc agctatgcaa ggagcctact tgccacagta tgcacatatg cagacgacag cggttcctgt tgaggaggca agtggtcaac agcaggtggc tgtcgagacg tctaatgacc attctccata tacctttcaa cctaataagt aa. It is sometimes possible for the material contained within the vial of "RBMS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.