Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASGRP3 cdna clone

RASGRP3 cDNA Clone

Gene Names
RASGRP3; GRP3
Synonyms
RASGRP3; RASGRP3 cDNA Clone; RASGRP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggatcaagtggccttgggaaagcagcaacattagatgaactgctgtgcacttgcattgagatgtttgatgacaatggagagctggataatagttatttgccaagaatagttctactgatgcaccgatggtatttatcttccactgaattggcagaaaaacttctctgcatgtatcgaaatgccactggagaaagctgcaatgaatttcgattaaagatctgctacttcatgaggtactggattctgaagtttcctgcagagtttaatttggatcttggtttgattcgtatgactgaggaatttcgggaagtagctagtcaactaggatatgaaaaacacgtcagcctcatcgacatatccagcattccttcctatgactggatgagaagagtcacacagaggaaaaaagtatccaagaagggaaaagcctgtctgctgtttgaccatctggagcccattgaattggctgagcacctcacttttctggagcataaatcttttagaaggatctcattcactgattaccaaagctatgtcatccatggctgcctggagaataatccaaccttggaaagatcgattgctttatttaatggaatctctaagtgggtccagttgatggttcttagcaaaccaaccccccagcaaagggcagaagtcatcacaaagtttatcaatgttgcaaagaagctccttcagctcaaaaattttaacaccctgatggcagtggtgggaggcctcagtcatagttccatttcacgcctcaaagagacccattctcatctttcttcagaagttacaaagaactggaatgaaatgacagagttggtctcctccaacggcaattactgcaattaccgcaaggcctttgccgactgcgatggcttcaaaatccccatccttggagtacacttgaaagacttgatagctgtccatgtcattttcccagactggacagaggagaacaaagtgaacattgtgaaaatgcaccagctctccgttaccctgagtgaactagtctccctgcagaatgcctctcaccacttagaacccaacatggatttgatcaacctgctcacgctttccctggacctctatcacactgaagatgatatttacaaactgtcactggtgctggagcctagaaattctaaatcgcagcctacctcccctacgacgcccaacaagcctgtggtacccctggagtgggcattaggggtgatgccaaagccagaccccacggtcatcaacaagcacataaggaaattagtggagtctgtatttagaaactatgatcacgaccatgatgggtacatttcccaagaggactttgaaagtatagctgccaattttcccttcttggattccttctgtgttctggacaaagatcaggatggcctaattagtaaagatgaaatgatggcttacttcctgagagctaaatcccaactacactgtaaaatgggaccaggatttatccataattttcaggagatgacctatctcaagccaaccttctgcgaacactgtgcgggatttctctggggcataatcaagcaaggatacaaatgcaaagactgtggagccaattgtcacaaacagtgcaaagacctcctggttctggcctgcaggagatttgcccgggcgccctccttgagcagtggtcatgggtcactgcctggaagcccctcgctgcccccagcgcaggatgaggtgtttgagttccctggagtcactgctggacacagggatttagacagcagagccatcacactggttacaggctcttctcgcaagatctctgtgaggctacagagggccaccaccagccaggccacccagactgaacctgtctggtcagaggctggctggggggactcggggtcccacaccttccctaaaatgaaatccaagttccatgacaaagcagcaaaggacaaaggctttgccaaatgggaaaatgagaagcccagggtgcatgctggtgtggatgttgtagaccggggcacggagtttgaacttgaccaggatgaaggagaagagaccagacaggatggtgaggatggctga
Sequence Length
2073
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,203 Da
NCBI Official Full Name
Homo sapiens RAS guanyl releasing protein 3 (calcium and DAG-regulated), mRNA
NCBI Official Synonym Full Names
RAS guanyl releasing protein 3
NCBI Official Symbol
RASGRP3
NCBI Official Synonym Symbols
GRP3
NCBI Protein Information
ras guanyl-releasing protein 3
UniProt Protein Name
Ras guanyl-releasing protein 3
UniProt Gene Name
RASGRP3
UniProt Synonym Gene Names
GRP3; KIAA0846
UniProt Entry Name
GRP3_HUMAN

NCBI Description

Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]

Uniprot Description

RASGRP3: Guanine nucleotide exchange factor (GEF) for Ras and Rap1. Belongs to the RASGRP family.

Protein type: GEFs; GEFs, Ras

Chromosomal Location of Human Ortholog: 2p25.1-p24.1

Cellular Component: plasma membrane

Molecular Function: GTPase activator activity; guanyl-nucleotide exchange factor activity; protein binding; Ras guanyl-nucleotide exchange factor activity; signal transducer activity

Biological Process: MAPKKK cascade; small GTPase mediated signal transduction

Research Articles on RASGRP3

Similar Products

Product Notes

The RASGRP3 rasgrp3 (Catalog #AAA1270333) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggatcaa gtggccttgg gaaagcagca acattagatg aactgctgtg cacttgcatt gagatgtttg atgacaatgg agagctggat aatagttatt tgccaagaat agttctactg atgcaccgat ggtatttatc ttccactgaa ttggcagaaa aacttctctg catgtatcga aatgccactg gagaaagctg caatgaattt cgattaaaga tctgctactt catgaggtac tggattctga agtttcctgc agagtttaat ttggatcttg gtttgattcg tatgactgag gaatttcggg aagtagctag tcaactagga tatgaaaaac acgtcagcct catcgacata tccagcattc cttcctatga ctggatgaga agagtcacac agaggaaaaa agtatccaag aagggaaaag cctgtctgct gtttgaccat ctggagccca ttgaattggc tgagcacctc acttttctgg agcataaatc ttttagaagg atctcattca ctgattacca aagctatgtc atccatggct gcctggagaa taatccaacc ttggaaagat cgattgcttt atttaatgga atctctaagt gggtccagtt gatggttctt agcaaaccaa ccccccagca aagggcagaa gtcatcacaa agtttatcaa tgttgcaaag aagctccttc agctcaaaaa ttttaacacc ctgatggcag tggtgggagg cctcagtcat agttccattt cacgcctcaa agagacccat tctcatcttt cttcagaagt tacaaagaac tggaatgaaa tgacagagtt ggtctcctcc aacggcaatt actgcaatta ccgcaaggcc tttgccgact gcgatggctt caaaatcccc atccttggag tacacttgaa agacttgata gctgtccatg tcattttccc agactggaca gaggagaaca aagtgaacat tgtgaaaatg caccagctct ccgttaccct gagtgaacta gtctccctgc agaatgcctc tcaccactta gaacccaaca tggatttgat caacctgctc acgctttccc tggacctcta tcacactgaa gatgatattt acaaactgtc actggtgctg gagcctagaa attctaaatc gcagcctacc tcccctacga cgcccaacaa gcctgtggta cccctggagt gggcattagg ggtgatgcca aagccagacc ccacggtcat caacaagcac ataaggaaat tagtggagtc tgtatttaga aactatgatc acgaccatga tgggtacatt tcccaagagg actttgaaag tatagctgcc aattttccct tcttggattc cttctgtgtt ctggacaaag atcaggatgg cctaattagt aaagatgaaa tgatggctta cttcctgaga gctaaatccc aactacactg taaaatggga ccaggattta tccataattt tcaggagatg acctatctca agccaacctt ctgcgaacac tgtgcgggat ttctctgggg cataatcaag caaggataca aatgcaaaga ctgtggagcc aattgtcaca aacagtgcaa agacctcctg gttctggcct gcaggagatt tgcccgggcg ccctccttga gcagtggtca tgggtcactg cctggaagcc cctcgctgcc cccagcgcag gatgaggtgt ttgagttccc tggagtcact gctggacaca gggatttaga cagcagagcc atcacactgg ttacaggctc ttctcgcaag atctctgtga ggctacagag ggccaccacc agccaggcca cccagactga acctgtctgg tcagaggctg gctgggggga ctcggggtcc cacaccttcc ctaaaatgaa atccaagttc catgacaaag cagcaaagga caaaggcttt gccaaatggg aaaatgagaa gcccagggtg catgctggtg tggatgttgt agaccggggc acggagtttg aacttgacca ggatgaagga gaagagacca gacaggatgg tgaggatggc tga. It is sometimes possible for the material contained within the vial of "RASGRP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.