Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAD54B cdna clone

RAD54B cDNA Clone

Gene Names
RAD54B; RDH54
Synonyms
RAD54B; RAD54B cDNA Clone; RAD54B cdna clone
Ordering
For Research Use Only!
Sequence
atgttggatcaccatcctgttgctattacagtggaggtgaagcaagaagaagacattaaaccacctcctccactggttttaaattctcaacagagtgatactttagagcaaagagaagaacatgaattagtacatgttatggaaagatccttgtcgccttcactttcctctgttgatatgagaatgacatcgtctccatcttctattccaaggagagatgatttttttcggcatgagagtggtgaacactttaggtcactattagggtatgatcctcagatcctgcaaatgttgaaagaggagcatcagataattttagaaaatcaaaaaaattttggattgtatgttcaggagaagagggatggattgaaaagaaggcagcagctagaggaagagctactaagagcaaaaattgaagtggagaagctgaaagcaattcgcttacggcatgatctacctgaatataacagtctctaa
Sequence Length
477
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,330 Da
NCBI Official Full Name
Homo sapiens RAD54 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
RAD54 homolog B (S. cerevisiae)
NCBI Official Symbol
RAD54B
NCBI Official Synonym Symbols
RDH54
NCBI Protein Information
DNA repair and recombination protein RAD54B
UniProt Protein Name
DNA repair and recombination protein RAD54B
UniProt Gene Name
RAD54B
UniProt Entry Name
RA54B_HUMAN

NCBI Description

The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]

Uniprot Description

RAD54B: Involved in DNA repair and mitotic recombination. May play an active role in recombination processes in concert with other members of the RAD52 epistasis group. Belongs to the SNF2/RAD54 helicase family.

Protein type: DNA repair, damage; EC 3.6.1.-; EC 3.6.4.-; Helicase

Chromosomal Location of Human Ortholog: 8q22.1

Molecular Function: DNA helicase activity; DNA translocase activity; protein binding; RNA helicase activity

Biological Process: double-strand break repair via homologous recombination; meiotic recombination; mitotic recombination

Disease: Lymphoma, Non-hodgkin, Familial

Research Articles on RAD54B

Similar Products

Product Notes

The RAD54B rad54b (Catalog #AAA1273634) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggatc accatcctgt tgctattaca gtggaggtga agcaagaaga agacattaaa ccacctcctc cactggtttt aaattctcaa cagagtgata ctttagagca aagagaagaa catgaattag tacatgttat ggaaagatcc ttgtcgcctt cactttcctc tgttgatatg agaatgacat cgtctccatc ttctattcca aggagagatg atttttttcg gcatgagagt ggtgaacact ttaggtcact attagggtat gatcctcaga tcctgcaaat gttgaaagag gagcatcaga taattttaga aaatcaaaaa aattttggat tgtatgttca ggagaagagg gatggattga aaagaaggca gcagctagag gaagagctac taagagcaaa aattgaagtg gagaagctga aagcaattcg cttacggcat gatctacctg aatataacag tctctaa. It is sometimes possible for the material contained within the vial of "RAD54B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.