RAB3B cdna clone
RAB3B cDNA Clone
Synonyms
RAB3B; RAB3B cDNA Clone; RAB3B cdna clone
Sequence
atggcttcagtgacagatggtaaaactggagtcaaagatgcctctgaccagaattttgactacatgtttaaactgcttatcattggcaacagcagtgttggcaagacctccttcctcttccgctatgctgatgacacgttcaccccagccttcgttagcaccgtgggcatcgacttcaaggtgaagacagtctaccgtcacgagaagcgggtgaaactgcagatctgggacacagctgggcaggagcggtaccggaccatcacaacagcctattaccgtggggccatgggcttcattctgatgtatgacatcaccaatgaagagtccttcaatgctgtccaagactgggctactcagatcaagacctactcctgggacaatgcacaagttattctggtggggaacaagtgtgacatggaggaagagagggttgttcccactgagaagggccagctccttgcagagcagcttgggtttgatttctttgaagccagtgcaaaggagaacatcagtgtaaggcaggcctttgagcgcctggtggatgccatttgtgacaagatgtctgattcgctggacacagacccgtcgatgctgggctcctccaagaacacgcgtctctcggacaccccaccgctgctgcagcagaactgctcatgctag
Sequence Length
660
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,758 Da
NCBI Official Full Name
Homo sapiens RAB3B, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB3B, member RAS oncogene family
NCBI Official Symbol
RAB3B
NCBI Protein Information
ras-related protein Rab-3B
UniProt Protein Name
Ras-related protein Rab-3B
Protein Family
UniProt Gene Name
RAB3B
UniProt Entry Name
RAB3B_HUMAN
Uniprot Description
RAB3B: Protein transport. Probably involved in vesicular traffic. Belongs to the small GTPase superfamily. Rab family.
Protein type: G protein, monomeric, Rab; G protein, monomeric; G protein
Chromosomal Location of Human Ortholog: 1p32-p31
Cellular Component: cytoplasm; perinuclear region of cytoplasm; vesicle
Molecular Function: GDP binding; GTPase activity; myosin V binding; protein binding
Biological Process: antigen processing and presentation; positive regulation of dopamine uptake
Research Articles on RAB3B
Similar Products
Product Notes
The RAB3B rab3b (Catalog #AAA1277689) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcag tgacagatgg taaaactgga gtcaaagatg cctctgacca gaattttgac tacatgttta aactgcttat cattggcaac agcagtgttg gcaagacctc cttcctcttc cgctatgctg atgacacgtt caccccagcc ttcgttagca ccgtgggcat cgacttcaag gtgaagacag tctaccgtca cgagaagcgg gtgaaactgc agatctggga cacagctggg caggagcggt accggaccat cacaacagcc tattaccgtg gggccatggg cttcattctg atgtatgaca tcaccaatga agagtccttc aatgctgtcc aagactgggc tactcagatc aagacctact cctgggacaa tgcacaagtt attctggtgg ggaacaagtg tgacatggag gaagagaggg ttgttcccac tgagaagggc cagctccttg cagagcagct tgggtttgat ttctttgaag ccagtgcaaa ggagaacatc agtgtaaggc aggcctttga gcgcctggtg gatgccattt gtgacaagat gtctgattcg ctggacacag acccgtcgat gctgggctcc tccaagaaca cgcgtctctc ggacacccca ccgctgctgc agcagaactg ctcatgctag. It is sometimes possible for the material contained within the vial of "RAB3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
