Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPN2 cdna clone

PTPN2 cDNA Clone

Gene Names
PTPN2; PTN2; PTPT; TCPTP; TC-PTP; TCELLPTP
Synonyms
PTPN2; PTPN2 cDNA Clone; PTPN2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaccaccatcgagcgggagttcgaagagttggatactcagcgtcgctggcagccgctgtacttggaaattcgaaatgagtcccatgactatcctcatagagtggccaagtttccagaaaacagaaatcgaaacagatacagagatgtaagcccatatgatcacagtcgtgttaaactgcaaaatgctgagaatgattatattaatgccagtttagttgacatagaagaggcacaaaggagttacatcttaacacagggtccacttcctaacacatgctgccatttctggcttatggtttggcagcagaagaccaaagcagttgtcatgctgaaccgcattgtggagaaagaatcggttaaatgtgcacagtactggccaacagatgaccaagagatgctgtttaaagaaacaggattcagtgtgaagctcttgtcagaagatgtgaagtcgtattatacagtacatctactacaattagaaaatatcaatagtggtgaaaccagaacaatatctcactttcattatactacctggccagattttggagtccctgaatcaccagcttcatttctcaatttcttgtttaaagtgagagaatctggctccttgaaccctgaccatgggcctgcggtgatccactgtagtgcaggcattgggcgctctggcaccttctctctggtagacacttgtcttgttttgatggaaaaaggagatgatattaacataaaacaagtgttactgaacatgagaaaataccgaatgggtcttattcagaccccagatcaactgagattctcatacatggctataatagaaggagcaaaatgtataaagggagattctagtatacagaaacgatggaaagaactttctaaggaagacttatctcctgcctttgatcattcaccaaacaaaataatgactgaaaaatacaatgggaacagaataggtctagaagaagaaaaactgacaggtgaccgatgtacaggactttcctctaaaatgcaagatacaatggaggagaacagtgagaggccaagattgacagacacctaa
Sequence Length
1062
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,017 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase, non-receptor type 2, mRNA
NCBI Official Synonym Full Names
protein tyrosine phosphatase, non-receptor type 2
NCBI Official Symbol
PTPN2
NCBI Official Synonym Symbols
PTN2; PTPT; TCPTP; TC-PTP; TCELLPTP
NCBI Protein Information
tyrosine-protein phosphatase non-receptor type 2
UniProt Protein Name
Tyrosine-protein phosphatase non-receptor type 2
UniProt Gene Name
PTPN2
UniProt Synonym Gene Names
PTPT; TCPTP
UniProt Entry Name
PTN2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. Multiple alternatively spliced transcript variants encoding different isoforms have been found. Two highly related but distinctly processed pseudogenes that localize to chromosomes 1 and 13, respectively, have been reported. [provided by RefSeq, May 2011]

Uniprot Description

PTPN2: a type 2 non-receptor phospho-tyrosine-protein phosphatase (PTP). Two alternatively spliced isoforms are differenyially expressed. Isoform A is a major PTP expressed in human tissues, while isoform B is expressed mainly in T-cells and in placenta.

Protein type: EC 3.1.3.48; Motility/polarity/chemotaxis; Protein phosphatase, tyrosine (non-receptor)

Chromosomal Location of Human Ortholog: 18p11.3-p11.2

Cellular Component: endoplasmic reticulum; ER-Golgi intermediate compartment; nucleoplasm; plasma membrane

Molecular Function: integrin binding; protein binding; protein kinase binding; protein tyrosine phosphatase activity; receptor tyrosine kinase binding; syntaxin binding

Biological Process: B cell differentiation; erythrocyte differentiation; glucose homeostasis; insulin receptor signaling pathway; negative regulation of cell proliferation; negative regulation of chemotaxis; negative regulation of epidermal growth factor receptor signaling pathway; negative regulation of inflammatory response; negative regulation of insulin receptor signaling pathway; negative regulation of macrophage differentiation; negative regulation of T cell receptor signaling pathway; negative regulation of tyrosine phosphorylation of Stat1 protein; negative regulation of tyrosine phosphorylation of Stat5 protein; positive regulation of gluconeogenesis; T cell differentiation

Research Articles on PTPN2

Similar Products

Product Notes

The PTPN2 ptpn2 (Catalog #AAA1265890) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccacca ccatcgagcg ggagttcgaa gagttggata ctcagcgtcg ctggcagccg ctgtacttgg aaattcgaaa tgagtcccat gactatcctc atagagtggc caagtttcca gaaaacagaa atcgaaacag atacagagat gtaagcccat atgatcacag tcgtgttaaa ctgcaaaatg ctgagaatga ttatattaat gccagtttag ttgacataga agaggcacaa aggagttaca tcttaacaca gggtccactt cctaacacat gctgccattt ctggcttatg gtttggcagc agaagaccaa agcagttgtc atgctgaacc gcattgtgga gaaagaatcg gttaaatgtg cacagtactg gccaacagat gaccaagaga tgctgtttaa agaaacagga ttcagtgtga agctcttgtc agaagatgtg aagtcgtatt atacagtaca tctactacaa ttagaaaata tcaatagtgg tgaaaccaga acaatatctc actttcatta tactacctgg ccagattttg gagtccctga atcaccagct tcatttctca atttcttgtt taaagtgaga gaatctggct ccttgaaccc tgaccatggg cctgcggtga tccactgtag tgcaggcatt gggcgctctg gcaccttctc tctggtagac acttgtcttg ttttgatgga aaaaggagat gatattaaca taaaacaagt gttactgaac atgagaaaat accgaatggg tcttattcag accccagatc aactgagatt ctcatacatg gctataatag aaggagcaaa atgtataaag ggagattcta gtatacagaa acgatggaaa gaactttcta aggaagactt atctcctgcc tttgatcatt caccaaacaa aataatgact gaaaaataca atgggaacag aataggtcta gaagaagaaa aactgacagg tgaccgatgt acaggacttt cctctaaaat gcaagataca atggaggaga acagtgagag gccaagattg acagacacct aa. It is sometimes possible for the material contained within the vial of "PTPN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.