Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMG1 cdna clone

PSMG1 cDNA Clone

Gene Names
PSMG1; PAC1; DSCR2; PAC-1; C21LRP; LRPC21
Synonyms
PSMG1; PSMG1 cDNA Clone; PSMG1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccacgttcttcggagaggtggtgaaggcgccgtgccgagctgggactgaggacgaagaggaggaggaggaggggcggagggagacgcccgaggacagggaggtgcgtctgcagctggcgcggaagagggaagtgcggctccttcgaagacaaacaaaaacatctttggaagtttctttgctagaaaaatatccgtgctccaagtttataattgctataggaaataatgcagtagcatttctgtcatcatttgttatgaattcaggagtctgggaggaagttggttgtgctaaactctggaatgaatggtgtagaacaacagacactacacatctgtcctccacagaggctttttgtgtgttttatcatctaaaatccaatccctcggtttttctctgtcagtgcagttgctatgttgcagaagatcaacagtatcagtggctggaaaaggtttttggctcttgtccaaggaagaacatgcagataactattctcacatgtcgacatgttaccgattataaaacctcagaatccaccggcagccttccttctcctttcctgagagccctaaaaacacagaatttcaaagactcggcgtgttgtccattgctagaacaaccgaatatagtacacgaccttcctgcagcagttctaagctactgtcaagtatggaaaatcccggcaattctgtacttgtgttatactgatgtgatgaaattagacctaatcacagtggaagcttttaagcctatactttctaccagaagcttgaagggtttggttaagaatattccccaaagcactgagatactaaagaaattgatgacaacaaatgagattcagagtaacatttatacatga
Sequence Length
867
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,288 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) assembly chaperone 1, mRNA
NCBI Official Synonym Full Names
proteasome assembly chaperone 1
NCBI Official Symbol
PSMG1
NCBI Official Synonym Symbols
PAC1; DSCR2; PAC-1; C21LRP; LRPC21
NCBI Protein Information
proteasome assembly chaperone 1
UniProt Protein Name
Proteasome assembly chaperone 1
UniProt Gene Name
PSMG1
UniProt Synonym Gene Names
C21LRP; DSCR2; PAC1; PAC-1; C21-LRP
UniProt Entry Name
PSMG1_HUMAN

Uniprot Description

DSCR2: Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG2. The PSMG1-PSMG2 heterodimer binds to the PSMA5 and PSMA7 proteasome subunits, promotes assembly of the proteasome alpha subunits into the heteroheptameric alpha ring and prevents alpha ring dimerization. Belongs to the PSMG1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytoplasm; endoplasmic reticulum; Golgi apparatus; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: proteasome assembly

Research Articles on PSMG1

Similar Products

Product Notes

The PSMG1 psmg1 (Catalog #AAA1276715) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcca cgttcttcgg agaggtggtg aaggcgccgt gccgagctgg gactgaggac gaagaggagg aggaggaggg gcggagggag acgcccgagg acagggaggt gcgtctgcag ctggcgcgga agagggaagt gcggctcctt cgaagacaaa caaaaacatc tttggaagtt tctttgctag aaaaatatcc gtgctccaag tttataattg ctataggaaa taatgcagta gcatttctgt catcatttgt tatgaattca ggagtctggg aggaagttgg ttgtgctaaa ctctggaatg aatggtgtag aacaacagac actacacatc tgtcctccac agaggctttt tgtgtgtttt atcatctaaa atccaatccc tcggtttttc tctgtcagtg cagttgctat gttgcagaag atcaacagta tcagtggctg gaaaaggttt ttggctcttg tccaaggaag aacatgcaga taactattct cacatgtcga catgttaccg attataaaac ctcagaatcc accggcagcc ttccttctcc tttcctgaga gccctaaaaa cacagaattt caaagactcg gcgtgttgtc cattgctaga acaaccgaat atagtacacg accttcctgc agcagttcta agctactgtc aagtatggaa aatcccggca attctgtact tgtgttatac tgatgtgatg aaattagacc taatcacagt ggaagctttt aagcctatac tttctaccag aagcttgaag ggtttggtta agaatattcc ccaaagcact gagatactaa agaaattgat gacaacaaat gagattcaga gtaacattta tacatga. It is sometimes possible for the material contained within the vial of "PSMG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.